Content uploaded by Oleg Shchepin
Author content
All content in this area was uploaded by Oleg Shchepin on Dec 18, 2016
Content may be subject to copyright.
Submitted 4 June 2014, Accepted 9 August 2014, Published online 17 May 2013
Corresponding Author: Novozhilov YK – e-mail – yurinovozhilov@gmail.com
New species of Diderma from Vietnam
Novozhilov YK1, Mitchell DW2, Okun MV1, 3, Shchepin ON1
1Komarov Botanical Institute of the Russian Academy of Sciences, Laboratory of Systematics and
Geography of Fungi, Prof. Popov Street 2, 197376 St. Petersburg, Russia
2 Walton Cottage, Upper Hartfield, East Sussex, TN7 4AN, England
3CIBIV –Center for Integrative Bioinformatics in Vienna, Max F. Perutz Laboratories (MFPL), University of Vienna,
Medical University of Vienna, Campus Vienna Biocenter 5 (VBC5), A–1030, Vienna, Austria
Novozhilov YK1 et al 2014 – New species of Diderma from Vietnam. Mycosphere 4(2), 363–454, Doi
10.5943/mycosphere/4/3/2
Abstract
During intensive studies of the taxonomy and ecology of myxomycetes in Cat Tien National
Park (southern Vietnam), two species of Diderma (myxomycetes) were collected during surveys
carried out in December 2010 and similar surveys carried out in November 2011 and 2012. These
new species, D. cattiense and D. pseudotestaceum, are described and illustrated. D. cattiense
resembles D. subasteroides in overall shape, colour and size of the sporocarps but has smaller
spores and the ornamentation of spores and the capillitium are different. The main morphological
differences between D. pseudotestaceum and D. testaceum lie in shape, colour of sporocarp,
columella, spore size and ornamentation. A phylogeny based on the small ribosomal subunit (SSU)
and elongation factor 1 alpha (EF1a) genes placed these new species in clades far apart from other
species of Diderma.
Key words – Amoebozoa – EF1a gene – molecular phylogeny – Myxogastria – plasmodial slime
moulds – SSU rRNA gene – Southeast Asia – taxonomy – tropics
Introduction
Surveys for myxomycetes carried out in lowland dense monsoon semideciduous tropical
forests in southern Vietnam in Cat Tien National Park (CTNP) by the first author in December
2010 yielded a series of collections of two species of Diderma that could not be identified in the
field. These same species were recorded again in CTNP in January 2011 and December 2012. Later
examination of these collections in the laboratory indicated that they did not fit any described
species of Diderma.
Materials & Methods
Isolates and morphology
This paper is based on field collections and material obtained from moist chamber cultures of
ground litter, aerial litter and bark collected from Cat Tien National Park (CTNP, 11°21′–11°48′ N,
107°10′–107°34′ E) which is located at the foot of the central Vietnamese highlands in Dong Nai
Mycosphere 4 (3): 363–454 (2013) ISSN 2077 7019
www.mycosphere.org Article Mycosphere
Copyright © 2014 Online Edition
Doi 10.5943/mycosphere/4/3/2
province, about 130 km northeast of Ho Chi Minh City. All parts of CTNP are hilly, with
elevations ranging between 120 and 220 m a.s.l. (sector Nam Cat Tien) and up to 372 m a.s.l.
(sector Tai Cat Tien) and 659 m a.s.l. (sector Cat Loc). There are numerous small rocky outcrops
and lowlands, with the latter usually flooded for several weeks during the rainy season. Lowlands
and flatlands are especially characteristic of the eastern part of the region bordering the Dong Nai
River. The general study area is characterized by a tropical monsoon climate with two distinct
seasons, a rainy season extending from late April to November and a dry season that lasts from
December to March. The mean annual temperature is approximately 26°C, with rather small
seasonal fluctuations. The annual rainfall varies from 1800–2500 mm, with the most rain falling
during August and September (400–450 mm per month), when much of the park area is inundated
with water. In contrast, there is almost no precipitation from January to March (Thinh & Anichkin
2011). The vegetation of CTPN is very diverse and includes more than 150 tree species, of which
Lagerstroemia calyculata (Lythraceae) along with various members of the Dipterocarpaceae,
Fabaceae and Datiscaceae often dominate both the upper canopy and subcanopy (Blanc et al. 2000,
Kuznetsov & Kuznetsova 2011, 2013). Most of the upper canopy trees are deciduous and shed their
foliage during the dry season. At the end of the dry season (April), a substantial amount of litter (up
to 800–1000 g m2) accumulates on the soil surface. However, with the onset of the rainy season this
litter is quickly consumed by termites and other soil invertebrates (Anichkin 2011).
The samples of substrate material used for preparing moist chamber cultures were collected
in November-December of 2010–2012. The specimens were air-dried in situ and transported back
to the laboratory in sealed paper bags. All the localities were geo-referenced with a portable GPS
device (WGS 84 mapping data). In the laboratory, cultures were prepared by placing pieces of
paper towel in Petri dishes (9 cm diam.) in such a way that most of the bottom surface of each dish
(ca 60 cm2) was covered. Cultures were flooded with distilled water. After 24 hrs the excess water
was poured off. Small amounts of water were added to the cultures at regular intervals to keep the
substrates moist. The cultures were maintained for up to three months under diffuse daylight at room
temperature (22–23°C) and examined for the presence of myxomycetes on six occasions (days 2–4,
6–8, 11–14, 20–22, 40–44 and 85–90). The pH of the wet substrate was determined using a Hanna
model 9024 pH meter with a flat surface electrode HI-1413 (with measurements taken for three
pieces of substrate) during the first examination (days 2–4, pH 6.01 ± 0.24 for all cultures
producing new species, n = 7). Sporocarps of the new species usually appeared within 20–22 days
after the moist chamber cultures were started, with the last sporocarps being found at days 40–44.
Voucher specimens are deposited in the collection of the first author in the mycological herbarium
of the Komarov Botanical Institute, Laboratory of Systematics and Geography of Fungi (LE).
Spore-to-spore cultures were prepared from mature sporocarps grown in moist chamber
cultures. Sporocarps were crushed and spores released over agar in sterile plastic Petri dishes with
1.5% water agar at pH 7.0; to facilitate germination some drops of distilled water were added.
Young plasmodia were transferred to agar enriched with sterilized oatmeal (Haskins and Basanta
2008). Cultures were kept at room temperature (20–23°C) in diffuse light.
Air-dried sporocarps were studied with a Zeiss Axio Imager A1 light microscope with
differential interface contrast (DIC), a Stemi 2000 dissection microscope and a JSM-6390 LA
scanning electron microscope (SEM) in the Komarov Botanical Institute RAS (St. Petersburg). For
microscopy, sporocarps were preserved as permanent slides in polyvinyl lactophenol. The freeware
program CombineZ was used to create stacked images under a Stemi 2000 dissection microscope.
Microscopic measurements were made with the program Axio Vision 4.8.0.0 (Carl Zeiss Imaging
Solutions GmbH, free licence). Spore features (diameter and spore ornamentation) were determined
for 10 spores per specimen for each of the specimens examined in detail. Observations of the spore
ornamentation by SEM have been made after applying the critical point drying technique (Singer et
al. 2005). Specimens for electron microscopy were mounted on copper stubs using double-sided
sticky film and sputter-coated with gold. Colour notations in parentheses are from the ISCC-NBS
colour-name charts illustrated with centroid colours (Anonymous 2012).
DNA extractions, PCR, DNA sequencing and phylogenetic analyses
DNA was extracted from sporocarps shock-frozen with liquid nitrogen and crushed using a
mortar and pestle. The resulting powder was diluted with PBS, and DNA was extracted with the
AxyPrep Multisource Genomic DNA Miniprep Kit according to the manufacturer’s instructions.
For 5 specimens we obtained partial SSU sequences (the first part of the gene, ca. 600 bp free of
introns) using the primer pair S1-SU19R (Fiore-Donno et al., 2008) (Table I). The amplification of
the partial EF1a gene (ca 900 bp) was performed in one run for 5 specimens. The primers PB1F-
PB1R for these amplifications were designed by the third author (Table I). Sequencing was carried
out at an ABI 3130 sequencer. All sequences reported as new in this paper have been deposited in
GenBank under accession numbers KJ659863 to KJ659867 for SSU and KJ676601 to KJ676605
for EF1a.
Table 1 Primers used in this study.
Primer name Sequence Melting temperature, ºC
S1 AACCTGGTTGATCCTGCC 62
SU19R TCGAGTAACAATTAGAGGACA 56
PB1F ACCCGTGAGCACGCTCTCCT 60
PB1R CGCACATGGGCTTGGAGGGG 60
The obtained sequence chromatograms were first checked for reading errors in Chromas Lite
(http://www.technelysium.com.au/chromas_lite.html) and aligned using MAFFT software version
6.935. From the resulting alignments with 631 nucleotide positions for the SSU gene and 249
amino acid positions for the EF1a gene we first constructed a Maximum Likelihood (ML) tree
using the IQ-Tree software version 0.9.6 (http://www.cibiv.at/software/iqtree/). The partition model
was used to create a phylogenetic tree based on both input alignments with independent model
parameters estimation. The TNe+G4 model was selected for the SSU partition and the WAG+I
model for the EF1a partition according to ModelTest implemented in IQ-Tree. 10000 ultrafast
bootstrap replicates were performed for obtaining confidence values for the branches. For the
Bayesian analysis, the MrBayes software was used (www.mrbayes.sourceforge.net/). The “mixed”
data type was used for the two partitions, allowing independent estimation of model parameters.
The GTR+I+G model was used for both partitions. Two chains with 1000000 generations each
were run; 10000 trees were sampled from each chain. All trees sampled before the convergence
value of the two chains reached a value less that 0.01 were discarded as burn-in. The resulting
18940 trees were summarized to a consensus. Since the tree topologies from the Bayesian and ML
analysis are identical, the bootstrap values from the ML analysis were drawn onto the Bayesian tree
with the IQ-Tree software.
Results
Diderma cattiense Novozh. & D.W. Mitch. sp. nov. Fig. 1
MycoBank MB 808647
GenBank KJ659863 (18S SSU), KJ676601 (EF1a)
Holotype – LE 286673
Etymology – The specific epithet refers to the geographical location of the find and is derived
from the name of the adjacent Cat Tien National Park.
Macromorphology – sporocarps grouped in small colonies (Figs. 1b, c), stipitate, 0.8–1.5 mm
tall. Hypothallus cartilaginous to membranous, moderate reddish brown (m.rBr 43), pleated toward
the stalk. Stalk 1/2–2/3 of the total height, straight, moderate reddish brown (m.rBr 43) flared at the
base (Fig. 1d), dark reddish brown (d.rBr 44) in the upper part, merging at the top into the disc-
shaped sporangial brownish black (brBlack 65) base without brown lines (Fig. 1f). Sporotheca 0.5–
1.0 mm diam., subglobose to subdiscoid with polyhedral dehiscence reticulum of light brown (l.Br
57) bands (Fig. 1d).
Micromorphology – peridium three-layered (Figs. 1h, j) composed of a smooth, glossy
moderate reddish brown (m.rBr 43), cartilaginous outer layer with dark brown spots visible in
transmitted light (Fig. 1i), middle white crystalline calcareous layer with lime globules and needles
(Figs. 1j, k), and an inconspicuous, membranous inner layer (Fig. 1j). Dehiscence apical and
floriform (Figs. 1e, f, g). Columella globose or subglobose (Fig. 1g), 0.15–0.25 mm diam.,
yellowish white (yWhite 92). Capillitium abundant, consisting of long, filiform threads c. 1 µm
diam., white under the dissecting microscope (Fig. 1g) and hyaline by transmitted light (Fig. 1 n),
sparingly branching and rarely anastomosed (Fig. 1l), marked with scattered numerous small
verrucae 0.5–1 µm high (Fig. 1m). Spores (brBlack 65) brownish black in mass, greyish reddish
brown (gy.rBr 46) by transmitted light (Fig 1 n), globose, 10.5–11.5 µm in diam., unevenly covered
by large blunt tuberous warts 0.4–0.6 µm in height (Figs. 1o, p). Plasmodium white.
Habitat – on strongly decayed coarse woody debris of unidentified trees (Fig. 1a), in a
monsoon deciduous lowland tropical forest.
Known distribution – known only from a few sites in the Cat Tien National Park in Lam
Dong Prov., southern Vietnam.
Material examined – Vietnam, Dong Nai Province, Tan Phu District, Cat Tien National Park,
right bank of the Dong Nai River (upper reach), the south Vietnamese lowland dense monsoon
semideciduous tropical secondary forest in depression with numerous coarse wood debris,
11°25´47.0´´ N 107°25´23.2´´E, 165 m a.s.l., on large rotten log of an undetermined tree covered
by mosses, 14th Nov 2011, Yu. Novozhilov (LE 286673 Holotype). The lowland dense monsoon
semideciduous tropical forest with rotanga palms (Calamus sp.), 11°26´31.0´´ N 107°25´56.0´´E,
140 m a.s.l., on rotten logs of unidentified trees covered by mosses, 30th Dec 2010, Yu.
Novozhilov (LE 221710, 221722, 291355). Near road from the Heaven streams, the south
Vietnamese lowland dense monsoon semideciduous tropical Dipterocarpus forest on well drained
sandy soil, 11°26´39.0´´ N 107°26´11.6´´E, 143 m a.s.l., on large log of an undetermined tree
covered by mosses, 31th Dec 2010, Yu. Novozhilov (LE 221712). The secondary forest with
numerous large lianas, near the plot «Afzelia», 11°25´47.0´´ N 107°25´23.0´´E, 165 m a.s.l., on
logs of unidentified trees covered by mosses, 23th Jan 2011, Yu. Novozhilov (LE 221712, 286697,
286700, 291287, 291292, 291293, 291340, 291341). The secondary forest in depression with
numerous large lianas and coarse woody debris, 11°25´47.6´´ N 107°25´31.8´´E, 173 m a.s.l., on
logs of unidentified trees covered by mosses, 24th Jan 2011, Yu. Novozhilov (LE 221729). The
lowland dense monsoon semi-decidous tropical forest with dominant trees of the second layer–
Sterculia, Syzygium and first layer–Haldinia, Hopea, Ficus, 11°26´32.1´´ N 107°24´56.0´´E, 154 m
a.s.l., on rotten logs of unidentified trees covered by mosses, 17th Dec 2012, Yu. Novozhilov (LE
286704, 286705, 286707).
Agar cultures were prepared for a total of 5 isolates (field specimens). Spores germinated in
all cultures 1–2 days after being sown on agar. Germination was through a V-shaped split in the
spore wall. Significant amount of amoeboflagellates encysted almost immediately after
germination; however, the population of myxamoebae grew rapidly, feeding on bacteria sown
accidentally with spores and remains of sporocarps. After 5–10 days small hyaline microplasmodia
looking like protoplasmodia appeared, ingesting microcysts and showing a slow irregular streaming
of cytoplasm with many large vacuoles. Phaneroplasmodia were observed first 21–26 days after
germination, and mature plasmodia were white and displayed feeding fronts up to 3 cm wide. In
one isolate (LE 221729) phaneroplasmodia appeared only after 85 days. The addition of sterilized
oat flakes appeared to be a crucial factor for growth of phaneroplasmodia. Agar cultures sporulated
in 2 of 5 isolates after 7.5–8.5 months of cultivation.
The features of the species were constant among all studied field collections as well as
specimens obtained in agar culture. Most microscopic characters were found to be stable. However,
the columella of sporotheca and the spores obtained in agar cultures are often larger (12.5–17.5 µm
in diam.). In contrast, the size and colour of sporothecae, as well as spore ornamentation were more
stable.
Notes – D. cattiense belongs in the subgenus Leangium and appears closest to D.
subasteroides M. L. Farr (1971) from which it differs in its peridium with polyhedral dehiscence
Figures 1 – Type locality and morphological characters of Diderma cattiense (LE ) a The large log
with strongly decayed wood and dense moss cushion on upper side – typical habitat of Diderma
cattiense (place where the type specimen LE 221444 was found marked by arrow), b Group of
mature sporocarps on decayed wood in the field, c Group of mature sporocarps under the dissection
microscope (DM, top view), d Two mature sporocarps with areolate peridium, (DM, side view), e
Opened sporocarps with hyaline capillitium and white inner layer of peridium (DM, side view), f
Opened sporocarp with the disc-shaped dark sporangial base (DM, bottom view), g Opened
sporocarp with large globose light columella (shown by arrow) and hyaline capillitium (DM), h
Scanning electron micrograph (SEM) of an opened sporocarp, i Portion of outer surface of
peridium marked by dark spots as visible with light microscope with differential interference
contrast (LM, DIC, ×100), j SEM micrograph of three-layered peridium with needles of lime
between outer and inner layers (middle layer of peridium shown by arrow), k SEM micrograph of
middle layer of peridium with lime needles, l SEM micrograph of capillitium, m SEM micrograph
of capillitium ornamentation, n Spores and hyaline capillitium (top and median view, LM, DIC,
×100), o SEM micrograph of a spore, p Spore ornamentation (SEM). – Bars: b = 1 cm; c–g, k =
500 µm; h = 100 µm; l = 50 µm; i–k, n = 10 µm; m, o–p = 1 µm.
reticulum of pale bands (Fig 1c, d), absence of distinct brown lines in dark brown basal discs of
sporotheca (Fig. 1f), crystalline middle layer of capillitium with lime needles (Figs. 1j, k), smaller
spores (Fig. 1n, 10.5–11.7 µm vs. 12–13 µm diam. in D. subasteroides), spore ornamentation
(unevenly covered by large verrucae, 0.4–0.6 µm height, Figs. 1o, p), pale, hyaline, simple, non-
reticulate, weakly dichotomous capillitium (Figs. 1g, l, m, n) vs. brown and reticulate in D.
subasteroides, and prominent, well developed, globose or subglobose columella (Fig. 1g).
The new species differs in a number of important characters from other species (Table 1) with
stalked sporocarps and three-layered (triple) peridium: D. asteroides (Lister & G. Lister) G. Lister
(Lister 1911), D. lohgadense S.D. Patil, R.L. Mishra & Ranade (Mishra & Ranade 1979), D.
petaloides Buyck (Buyck 1983), D. stellulum M. L. Farr (Farr 1988), and D. yucatanense Estrada,
Lado & S. L Stephenson (Lado et al. 2003). The former can be distinguished from D. cattiense for
its discoid pinkish or light brown sporothecae and pulvinate columella. Diderma lohgadense has
saucer shaped or inverted bell-shaped sporotheca unlike subglobose sporotheca of D. cattiense.
Diderma petaloides and D. stellulum have reticulate capillitium, the threads with numerous dark
brown, expanded junctions and expansions, the former additionally has large spores (14–16 μm),
paler on one side and marked with spinules and blunt warts arranged in a subreticulate pattern. D.
asteroides differs in its short-stipitate or sessile habit.
Table 2 Comparison of morphological characters of Diderma cattiense and six other similar
species of Diderma.
Diderma
Characters DIDcat DIDsub DIDast DIDloh DIDpet DIDste DIDyuc
Total height
of sporocarp
(mm)
0.8–1.5 1.2–1.8 0.5–1.0 l.0–l.4 1.2–1.8 2.5–3.0 0.6–0.9
Sporotheca
diam. (mm) 0.5–1.0 0.5–1.0 0.5–1.0 1.0–1.6 0.8–1.0 1.8–2.0 0.4–1.0
Colour of
sporotheca
glossy
moderate
reddish
brown with
polyhedral
dehiscence
reticulum of
light brown
bands
evenly
coloured,
glossy
brown
glossy,
dark red-
brown
dark
chestnut
brown to
reddish
brown
dark
greyish
brown with
polyhedral
pale
dehiscence
lines
brown
yellowish
pink to
light
reddish
brown
Shape of
sporotheca
subglobose
to
subdiscoid
hemisphae
rical to
subdiscoid
subglobose
or slightly
prolate
saucer
shaped or
inverted
bell-
shaped
subglobose
to
subdiscoid
subglobose
hemisphe-
ric
depressed
to discoid,
slightly
umbilicate
above
Stalk size %
of the total
height
50–60 60–70 0–10 75–80 50–60 50–60 50–60
Middle layer white, white white and white and white and white and white,
of peridium calcareous,
crystalline
with lime
needles
noncrystal
line,
calcareous
without
lime
needles
calcareous calcareous calcareous calcareous calcareous
Shape of
columella
globose or
subglobose flat
hemispheri
cal or
conical
thickened
base of
sporotheca
hemispheri-
cal or
clavate
flat or
thickened
base of
sporotheca
pulvinate
Colour of
columella
yellowish
white
whitish to
pale flesh-
coloured
whitish to
pale flesh-
coloured
reddish
brown pale
cream or
with pale
pinkish
light
brownish
Capillitium sparingly
branching reticulate
weakly
dichotomo-
us,
sometimes
with a few
anastomos
es forming
a large-
meshed net
branched
with the
joints
expanded
branched
and
anastomos-
ed
reticulate sparingly
branching
Colour
capillitium
in mass
white pallid colourless
dark
brownish
dark
brownish
pale to
dark
brown
brown
Colour
capillitium in
transmitted
light
hyaline brown hyaline brown brown brown brown
Colour
spores in
mass
brownish
black
dark
brown dark brown black dark brown blackish
brown
dark
brown to
blackish
Colour
spores in
transmitted
light
greyish
reddish
brown
dark
brown
brown-
violet
dark
brown
orange-
greyish
brown
dark
brown
greyish
brown
Spore diam.
(µm) 10.5–11.5 12–13.0 10.0–12.0 9.5–12.0 10.5–11.5 14.0–16.0 7.5–9.5
Spore
ornamentati
on
unevenly
covered by
large blunt
tuberous
warts
densely
and
uniformly
warted
distinctly
verruculose spinose densely
verruculose
spinose,
verrucose,
subreticulo-
se
densely
and
uniformly
warted
Abbreviations: DIDcat – Diderma cattiense, DIDsub – D. subasteroides, DIDast – D. asteroides,
DIDloh – D. lohgadense, DIDpet – D. petaloides, DIDste – D. stellulum, DIDyuc – D.
yucatenense.
Diderma pseudotestaceum Novozh. & D.W. Mitch. sp. nov. Fig. 2
MycoBank MB 808648
GenBank KJ659866 (18S SSU), KJ676604 (EF1a)
Holotype – LE 291396
Etymology – From the Latin pseudo (seeming), referring to the similarity of this species to
Diderma testaceum.
Macromorphology – sporocarps in small groups, sessile, flat-pulvinate, rounded, slightly
umbilicate above, 0.3–0.7 mm diam., white (White 263) but never pinkish. Hypotallus distinct,
white, calcareous or thin, delicate, colourless.
Micromorphology –peridium double, outer layer white smooth, polished, porcelain-like with
white inner surface, fragile, consisting of lime globules 1.5–2.5 µm diam., inner layer membranous
bluish white (bWhite 189) under the dissection microscope. Dehiscence apical and frequently
breaking to leave a ridge. Columella indefinite as a thickened light yellowish pink (l.yPk 28) or
light orange (l.O 52) base of sporocarp. Capillitium abundant, consisting of filiform threads c. 0.5
µm diam., white under the dissecting microscope and hyaline by transmitted light, sparingly
branching with membranous expansions. Spores dark grey (d.Gy 266) or black (Black 267) in
mass, pale yellowish pink (p.yPk 31) or brownish pink (brPk 33) by transmitted light, globose, 6.2–
7.2 µm in diam., verruculose, unevenly covered by warts, some of the warts in clusters.
Plasmodium unknown.
Habitat – on ground litter and litter accumulated on large logs of trees, in a monsoon
deciduous lowland tropical forest.
Known distribution – known only from a few sites in the Cat Tien National Park in Lam
Dong Prov., southern Vietnam.
Material examined – Vietnam, Dong Nai Province, Tan Phu District, Cat Tien National Park,
right bank of the Dong Nai River (upper reach), trail to the tree of Uncle Dong, the south
Vietnamese lowland dense monsoon semideciduous tropical forest with Lagerstroemia calyculata
dominated stands, 11°26´16.9´´ N 107°25´22.0´´E, 125 m a.s.l., on leaf litter, 29th Nov. 2012, Yu.
Novozhilov (LE 291396 Holotype). The south Vietnamese lowland dense monsoon semideciduous
tropical forest with Lagerstroemia calyculata dominated stands 11°26´38.9´´N 107°23´49.0´´E, 166
m a.s.l., on ground litter, 20th Nov 212, Yu. Novozhilov (LE 291320). The dense monsoon semi-
decidous secondary tropical forest with numerous large lianas with Afzelia xylocarpa and Ficus sp.
dominated stands, 11°26´08.0´´N 107°25´27.3´´E, 135 m a.s.l., on ground litter, 2th Jan 2011, Yu.
Novozhilov, in moist chamber cultures (LE 297164, 297165, 297486), field collections (LE
291397, 291398, 291399, 291400). The dense monsoon semi-decidous secondary tropical forest
with numerous large lianes with Afzelia xylocarpa and Ficus sp. dominated stands, 11°26´15.5´´N
107°25´18.9´´E, 152 m a.s.l., on ground litter, 16th Nov 2011, Yu. Novozhilov, field collections
(LE 286716, 286718, 286751). The secondary dense forest with numerous large lianas,
Lagerstroemia calyculata, sagos and giantic aroids, 11°27´05.4´´N 107°21´24.9´´E, 162 m a.s.l., on
ground litter, 27th Jan 2011, Yu. Novozhilov, in moist chamber culture (LE 297199).
Figures 2 – Type locality and morphological characters of Diderma pseudotestaceum (LE 291396)
and morphological characters of D. testaceum (LE 297668) a The large log with strongly decayed
wood covered by leaf litter on upper side – typical habitat of D. pseudotestaceum (place where the
type specimen LE 291396 was collected marked by arrow), b Group of mature sporocarps on leaf
litter in the field (side view), c Group of mature sporocarps with reddish bottom under the
dissection microscope (DM, top view), d Scanning electron micrograph (SEM) of an opened
sporocarp, e SEM micrograph of a portion of outer surface covered by lime granules, f SEM
micrograph of capillitium, g Spores and hyaline capillitium as visible with light microscope with
differential interference contrast (top and median view, LM, DIC, ×100), h SEM micrograph of a
spore, i Spore ornamentation (SEM), j Group of mature sporocarps of D. testaceum with pinkish
peridium (DM), k An opened sporocarp of D. testaceum with large reddish columella (DM), l
Spores and hyaline capillitium of D. testaceum (median view, LM, DIC, ×100). – Bars: b, c, k =
500 µm; d = 100 µm; e, f = 5 µm; g, l = 10 µm; h = 1 µm; i = 0.5 µm; j = 1000 µm.
Notes – The twelve collections studied were found in six localities at different times, on
ground litter and litter that accumulated on the surface of large logs of trees. In each case, the
fructifications were very scanty, consisting of small groups (10–30) of sporocarps. The features of
the species were constant among all studied field collections as well as specimens obtained in moist
chamber cultures. Most microscopic characters were found to be stable. However, the capillitium of
sporocarps obtained in moist chamber cultures were often scanty. In contrast, the shape and size of
sporothecae and spores, shape and colour of columella, as well as spore ornamentation, were more
stable.
Some sporocarps were used in attempts to establish spore to spore agar cultures (Haskins &
Wrigley de Basanta 2008). However, these attempts failed and observations of spores in hanging
drops showed that they did not germinate within three days.
Macroscopically, this species slightly looks like D. testaceum. However we assume that
pinkish colour of sporocarps (Figs. 2j, k) as well as prominent, convex reddish brown columella
(Fig. 2k) are typical characteristics of Diderma testaceum «sensu stricto». Diderma
pseudotestaceum is best distinguished from this species by the clear white colour of the peridium,
flat-pulvinate and umbilicate above the sporotheca and absence of a prominent columella.
Interestingly, a similar morphotype was described from Taiwan (Chung and Liu 1998). These
authors noted that their specimens differed from the typical form of D. testaceum in having a white
inner surface of outer peridium and undeveloped columellae, nevertheless they retain this form as
D. testaceum.
Molecular analysis – For the comparison of molecular characteristics of the two new
Diderma species, we obtained 5 partial 18S ribosomal DNA (SSU) as well as 5 partial elongation
factor alpha (EF1a) sequences.
A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) revealed that the closest sequenced
Diderma species to D. cattiense are D. niveum (according to the 18S SSU gene) and D. globosum
var. europaeum (according to the EF1a gene). The closest species to D. pseudotestaceum was D.
alpinum. The mentioned taxa were then used in a two-gene phylogenetic analysis including two
samples of D. cattiense and 3 samples of D. pseudotestaceum.
The analyzed taxa, D. cattiense and D. pseudotestaceum, each form a separate monophyletic
clade on the phylogenetic tree with maximal Bayesian and bootstrap support values, thus
supporting the species status of these taxa (Fig. 3). The GenBank accession numbers for third-party
sequences used in this analysis are given in the Table 3. Since morphologically D. pseudotestaceum
is similar to D. testaceum, 18S SSU sequence of the latter species (GenBank accession number
AB259385, Kamono & Fukui 2006) was involved in the molecular analysis. This is the only
trustworthy 18S SSU sequence of D. testaceum available in the GenBank database. However, this
sequence shows a fair amount of genetic divergence which hampers a proper alignment and tree
reconstruction. Thus, this sequence was excluded from further analysis.
The results of molecular analysis support the recognition of two new morphospecies,
Diderma cattiense (a liginicolous species) and D. pseudotestaceum (a litter inhabitant) both of
which are seemingly common in lowland monsoon tropical forests of the Cat Tien National Park.
Figures 3 – Phylogenetic tree based on the partial 18S SSU gene sequence (629 bp) and the partial
EF1a gene sequence (246 a/a) of 9 taxa. Support values of Bayesian posterior probability (0–1) and
ultra-fast bootstrap support (0–100) are given for each node. Clusters representing D. cattiense and
D. pseudotestaceum are shaded grey. Physarum pseudonotabile (Novozhilov et al. 2013) was used
as the outgroup. Scale bar indicates 0.04 substitutions per site.
Table 3 List of GenBank accession numbers of third-party sequences used in the phylogenetic
analysis.
Species 18S SSU EF1a
D. niveum HE614616 GU289200
D. globosum var. europaeum DQ903677 EF513191
D. alpinum JQ900778 GU289199
Acknowledgments
We gratefully acknowledge the technical support (SEM) provided by Ludmila A. Kartzeva,
St. Petersburg (Komarov Botanical Institute RAS). The authors are grateful to the administration of
the Joint Russian Vietnamese Tropical Research and Technological Centre and Cat Tien National
Park and to A. N. Kuznetzov and A. E. Anichkin for their assistance in the organization of
fieldwork. Expeditions and laboratory work were supported by the Russian Found for Basic
Research (grant 13–04–00839-a, 12–04–33018 mol-a-ved) and the program Ecolan–1.2 of the
Russian-Vietnamese Tropical Scientific and Technological Centre.
References
Anichkin AE. 2011 – Dynamics of plant litter decomposition. Structure and functions of soil
communities of a monsoon tropical forest (Cat Tien National Park, southern Vietnam). KMK
Scientific Press, Moscow 44–75 [in Russian].
Anonymous. 2012 – NBS/ISCC Colour System. Original and Improved 267 Colour Centroids.
Washington, Inter-Society Colour Council. National Bureau of Standards. http://tx4.us/nbs-
iscc.htm (Consulted 20 April 2014).
Blanc L, Maury-Lechon G, Pascal J.-P. 2000 – Structure, floristic composition and natural
regeneration in the forests of Cat Tien National Park, Vietnam: an analysis of the
successional trends. Journal of Biogeography 27, 141–157.
Buyck B. 1983 – Diderma petaloides Buyck, a new Myxomycete from Rwanda. Bulletin du Jardin
Botanique National de Belgique 53(1–2), 294.
Chung CH, Liu CH. 1998 – Myxomycetes of Taiwan IX. The genus Diderma (Physarales).
Taiwania 43(1), 12–26.
Farr ML. 1971 – Two undescribed Myxomycetes from Argentina. Mycologia 63 (3), 634–639.
Farr ML. 1988 – Notes on Mycetozoa V. Corrections, redispositions, and new taxa. International
journal of mycologie and lichenology 3, 199–213.
Fiore-Donno AM, Meyer M, Baldauf SL, Pawlowski J. 2008 – Evolution of dark-spored
Myxomycetes (slime-molds): molecules versus morphology. Mol. Phylogenet. Evol. 46 (3),
878–889.
Haskins EF, Wrigley de Basanta D. 2008 – Methods of agar culture of myxomycetes: an overview.
Revista Mexicana de Micología 27, 1–7.
Kamono A, Fukui M. 2006 – Rapid PCR-based method for detection and differentiation of
Didymiaceae and Physaraceae (myxomycetes) in environmental samples. J. Microbiol.
Methods 67(3), 496–506.
Kuznetsov AN, Kuznetsova SP.2011 – Forest vegetation: species composition and stand structure.
Structure and functions of soil communities of a monsoon tropical forest (Cat Tien National
Park, southern Vietnam). KMK Scientific Press, Moscow 16–43 [in Russian].
Kuznetsov AN, Kuznetsova SP. 2013 – Tropical Monsoon Forests of Vietnam (Results of 20 Years
of Phytoecological Research). Biology Bulletin 40(2), 187–196.
Lado C, Estrada-Torres A, Stephenson SL, Wrigley de Basanta D, Schnittler M. 2003 –Biodiversity
assessment of myxomycetes from two tropical forest reserves in Mexico. Fungal Diversity
12, 67–110.
Lister G. 1911 – A monograph of the Mycetozoa; a descriptive catalogue of the species in the
Herbarium of the British Museum. London, British Museum.
Mishra RL., Ranade VD. 1979 – Myxomycetes of Maharashtra-II. The genus Diderma Pers.
Maharashtra Vidnyan Mandir Patrika 14(1), 33–41.
Novozhilov YK, Okun MV, Erastova DA, Shchepin ON, Zemlyanskaya IV, García-Carvajal E,
Schnittler M. 2013 – Description, culture and phylogenetic position of a new xerotolerant
species of Physarum. Mycologia 105:1535–1546.
Singer H, Moreno G, Illana C. 2005 – Revision of type material of nivicolous species of
Stemonitales. Persoonia 18(4), 485–497.
Thinh NV, Anichkin AE. 2011 – The Cat Tien National Park: general information. Structure and
functions of soil communities of a monsoon tropical forest (Cat Tien National Park, southern
Vietnam). KMK Scientific Press, Moscow 11–16 [in Russian].
