Calypogeia (Calypogeiaceae, Marchantiophyta) in Pacific Asia: Updates from Molecular Revision with Particular Attention to the Genus in North Indochina
by
, , , and
Vadim A. Bakalin
1,*
,
Yulia D. Maltseva
1,
Frank Müller
2,
Ksenia G. Klimova
1,
Van Sinh Nguyen
3,
Seung Se Choi
4,* and
Aleksey V. Troitsky
5,* 1
Laboratory of Cryptogamic Biota, Botanical Garden-Institute FEB RAS, Makovskogo Street 142, 690024 Vladivostok, Russia
2
Institut für Botanik, Technische Universität Dresden, 01062 Dresden, Germany
3
Institute of Ecology and Biological Resources, Graduate University of Science and Technology, Vietnam Academy of Science and Technology, Ha Noi 10000, Vietnam
4
Team of National Ecosystem Survey, National Institute of Ecology, Seocheon 33657, Korea
5
Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, Leninskie Gory 1, 119991 Moscow, Russia
*
Authors to whom correspondence should be addressed.
Plants 2022, 11(7), 983; https://doi.org/10.3390/plants11070983
Submission received: 16 February 2022
/
Revised: 28 March 2022
/
Accepted: 1 April 2022
/
Published: 4 April 2022
(This article belongs to the Special Issue Plant Genosystematics)
Abstract
:Calypogeia is a genus in Pacific Asia that is difficult to classify taxonomically. These difficulties arise from (1) considering the presence of oil bodies as anatomical characters for taxonomic differentiation, (2) the wide occurrence of sibling, semicryptic and geographical vicariant taxa and (3) the inevitable need to organize new datasets for molecular genetic revision of the genus. The present study uses an integrative approach, including molecular genetic, morphological, chorological and ecological methods, to understand the taxonomy of the genus in Amphi-Pacific Asia. As a result, a set of new-to-science taxa was revealed, and the suite of morphological features necessary for reliable discrimination of the taxa was revised. These results are based on the study of a large set of ‘fresh’ collections suitable for molecular analysis and morphological comparison and include data on oil bodies. The most basal branch in Calypogeia s.l. is segregated into a new genus, Asperifolia. Descriptions of the new taxa and the key to Calypogeia in Vietnam are provided.
Keywords:
Calypogeiaceae; phylogeny; taxonomy; geographic vicariants; speciation; liverworts; Hepaticae1. Introduction
Calypogeia is one of the most taxonomically complex genera in Asia, and its representatives are difficult to identify and classify [1]. These difficulties are mostly due to (1) the great taxonomic value placed on features of intracellular organelles called oil bodies for traditional (morphological) systematics (these organelles rapidly decompose, even under optimal storage conditions) and (2) the presence of a large number of semicryptic species, which differ slightly in morphology, especially in a dried state [2,3,4,5,6,7]. A review of the genus in the Sino-Himalaya based on available literature data and the study of type specimens was previously provided by our group [1]. As expected, the molecular genetic exploration undertaken in the present study revealed a number of species that need to be described as new to science, as they are not conspecific to morphologically similar taxa known from Europe and North America. In addition, the complex of taxa in the branch sister to all other Calypogeia should be considered the new genus Asperfolia. To confirm these results, we compiled a dataset of specimens for use in molecular genetic analysis. The previously obtained material from Pacific Asia that was used in the present work was only available for blue oil-bodied Calypogeia (mostly data from Bakalin et al. [2] and Buczkowska et al. [7], other data were scant).
The initial purpose of this work was to revise the taxonomy of the genus in Northern Indochina. However, when we added a number of Calypogeia specimens from adjacent regions (China, Japan and the Russian Far East) and European accessions available on GenBank to the dataset (especially species considered morphologically similar to those known in Indochina), we found that the northern part of Pacific Asia contains species that are genetically different from those described in Europe (where many have a type locality) but instead belong to other undescribed taxa. Therefore, to discriminate the taxa distributed in SE Asia from the northern allies, we first need to discriminate the Asiatic ‘northern allies’ from the morphologically similar taxa known in Europe and North America. As a result, in addition to considering the actual species found in North Indochina, it was necessary to describe a number of species from extratropical Pacific Asia, which helped to avoid confusion. In fact, a revision of the Calypogeia found in Pacific Asia was obtained, except for a few taxa described from Japan (which were discussed in our previous work [1], since the “fresh” material suitable for molecular genetic analysis was not available for some Japan-derived taxa). Therefore, the goal of this study was to describe species that were new to science and widespread in Pacific Asia. Additionally, we aimed to assess phytogeographic speculations on the distribution patterns of taxa based on the largest dataset for the genus using both molecular genetic and morphological methods enriched with data on the ecology and geography of the taxa.
2. Results
The phylogeny of Calypogeia taxa and closely related species was inferred from two regions of chloroplast DNA, the trnG intron and trnL−F spacer and nuclear ITS2. A list of accessions from which these sequences were available is presented in Table 1. The sets of accessions for the three DNA markers overlap only partially.
For the trnG intron, the alignment of 87 sequences consisted of 685 positions, among which 217 were parsimony informative, 93 were singletons and 375 were constant sites. The base frequencies across all sites were A: 0.344, C: 0.161, G: 0.129 and T: 0.365. The maximum likelihood (ML) criterion resulted in a consensus tree with a log likelihood of −3970.540. The maximum parsimony (MP) analysis yielded two equally parsimonious trees with lengths of 573 steps, a CI = 0.557809 and an RI = 0.854570. A consensus phylogenetic tree retained under Bayesian analysis (BA), along with the MP and ML bootstrap support (BS) values and the Bayesian posterior probabilities (PP) for each node are on Figure 1 (BA 50% majority rule consensus tree is on Figure S1).
All methods resulted in an almost identical tree topology. The differences concern the relative position of some low supported branches. Calypogeia accessions are organized into 11 supported clades; however, the relationships between these clades are poorly resolved. On the TCS haplotype network of trnG sequences (Figure 2), three groups of Calypogeia taxa were resolved.
Table S1 shows the p-distances for the trnG sequences as well as those for the other two markers studied between Calypogeia and species designated Asperifolia, which was previously considered to be Calypogeia. On the phylogenetic trees, the Calypogeia species clustered together and are separated by long branches from a group of other Calypogeiaceae taxa: Mnioloma and Metacalypogeia. The large gap between p-distances among the Calypogea species and the group of other species, including Asperifolia, is illustrated in Figure 3.
The trnL–F phylogeny is shown in Figure 4 (BA 50% majority rule tree is shown in Figure S2). The alignment of 88 trnL–F sequences consisted of 512 positions, among which 146 were parsimony informative, 77 were singletons and 289 were constant sites. The base frequencies across all sites were A: 0.354, C: 0.143, G: 0.189 and T: 0.344. The ML criterion resulted in a consensus tree with a log likelihood of −3059.604. The MP analysis yielded two equally parsimonious trees with lengths of 215 steps, a CI = 0.631579 and an RI = 0.894419. The arithmetic means of the log likelihoods from the Bayesian analysis for each sampling run were −3155.54 and −3159.26. The bars on the left (yellow) are based on within-Calypogeia distances, and those on the right are based on distances involving other genera (blue).
The ITS2 phylogenetic tree shown in Figure 5 (BA 50% majority rule tree is shown in Figure S3) was constructed from an alignment of 77 sequences that contained 553 positions, of which 149 were parsimony informative, 88 were singletons and 316 were constant sites. The base frequencies across all sites were A: 0.250, C: 0.250, G: 0.250 and T: 0.250. The ML criterion resulted in a consensus tree with a log likelihood of −3296.308. The MP analysis for ITS2 yielded three equally parsimonious trees with lengths of 455 steps, a CI = 0.712088 and an RI = 0.829870. The arithmetic means of the log likelihoods from the Bayesian analysis for each sampling run were −3360.95 and −3360.13.
The basal position on the phylogenetic tree is occupied by the species Mesoptychia (Jungermanniaceae), used as an outgroup, followed by Geocalyx (Geocalycaceae) and then Metacalypogeia (Calypogeiaceae).
Differences in the accessions used to produce sequences of three DNA regions do not allow the construction of a combined tree. The arrangement of Calypogeia taxa is not identical across the trees constructed from three DNA markers. Such discrepancies are due to short internode lengths, which resulted in low support values.
On the phylogenetic trees, the Asperifolia taxa are no less distant from Calypogeia than Mnioloma, another genus of Calypogeiaceae, which allows us to ascribe the rank of a genus to these liverworts.
The p-distances between Asperifolia and three other Calypogeiaceae genera involved in this study (Calypogeia, Mnioloma and Metacalypogeia), Geocalyx (Geocalycaceae) and Mesoptychia (Jungermanniaceae), as well as those between all mentioned taxa, are nearly the same (Table 2).
3. Discussion
3.1. On Calypogeia arguta Nees et Mont. and Its Relatives
The basal group of species on the phylogenetic trees separated by a long branch from other Calypogeia includes C. arguta and its relatives previously attributed to Calypogeia subg. Asperifoliae (Warnst.) R.M. Schust.
The genetic distance between this group and the rest of Calypogeia far exceeds the Calypogeia infrageneric distances (Figure 1, Figure 2, Figure 3, Figure 4,Figure 5 and Table S1), which allows the ranking of the Calypogeia subg. Asperifoliae into the genus Asperifolia. The distant position of Asperifolia arguta and its relatives from the bulk of Calypogeia was also shown by morphological analysis as early as 1917 by Warnstorf [8], who proposed the unranked taxon ‘Asperifoliae’ within Calypogeia. Later, Schuster [9], following Müller [10], proposed Calypogeia subg. Asperifoliae based on that unranked taxon. Schuster (l.c.) also showed that aside from “vague and quantitative differences” in sterile plant morphology ([9]: 117), there is a valuable feature in the structure of the capsule wall outer layer, where the cells are of nearly the same width as inner cells and each fourth longitudinal wall is free of thickenings (versus epidermal cells nearly twice as wide as inner cells and every other longitudinal wall not being thickened). We were unable to check this feature in our Indochinese materials. Moreover, we did not genetically test the taxonomic position of Calypogeia arguta named specimens collected in East Asia; therefore, we could not identify whether ‘C. arguta’ from East Asia is the same taxon as that we revealed in Indochina, whether it is the same as European accessions or whether it belongs to its own species that needs to be described. Being unable to resolve this problem, we provide a description of Asperifolia indosinica in this paper. The species resembles C. arguta morphologically, although it differs in somewhat smaller cells and smaller underleaves.
3.2. On Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva
The small-sized Calypogeia growing over Sphagnum in the raised oligotrophic Sphagnum mires (Hoohmoore) and characterized by distanced leaves was commonly automatically referred to as C. sphagnicola in floristic practice. However, in the southern half of the Russian Far East, the specimens resembling this species have larger midleaf cells than those of ‘true’ C. sphagnicola based on European accessions. Moreover, aside from Sphagnum mires, conditional ‘C. sphagicola’ in the Russian Far East was also rarely observed over moist rocky outcrops.
The molecular genetic analysis performed here showed robust differences between populations of C. sphagnicola and the species resembling it in the southern areas of the Russian Far East and was treated here as C. pseudosphagnicola, which clustered with C. sphagnicola f. paludosa (Figure 1 and Figure 4).
The latter is genetically very distant from Calypogeia sphagnicola f. sphagnicola; therefore, f. sphagnicola and f. paludosa cannot belong to the same species. Therefore, the status of C. sphagnicola f. paludosa remains unclear, and subsequent segregation is needed.
Geographically (according to available data), the areas of the two taxa somewhat overlap. However, the vast majority of localities of C. pseudosphagnicola lie southward of the middle part of the Khabarovsk Territory (i.e., southward of the 50-th latitude), while C. sphagnicola in Pacific Asia is widely distributed in NE Asia, including the Kamchatka Peninsula and Magadan Province, although it was once found in northern Sikhote-Alin (Khab-68-14-18). It is worth mentioning that although Calypogeia sphagnicola specimens from the Russian Far East belong to the same clade as European accessions of the same species, the genetic distance between them is quite high, and the status of Far Eastern populations of the species should be revised (as they may belong to another subspecies or even species).
3.3. On Calypogeia subalpina Inoue
Although C. subalpina was described at the species rank [11], it was not recognized at that rank even by the author of the taxon, who changed it to a subspecies of C. neesiana [12]. On the trnG and trnL–F trees (Figure 1 and Figure 4) as well as on the trnG haplotype network (Figure 2), these two species are clustered together with maximal support values; these species are absent from the ITS2 dataset. Calypogeia subalpina seems to be restricted by temperate and hemiboreal insular-peninsular Pacific Asia, whereas ‘true’ C. neesiana may be restricted in its distribution in Asia by the boreal and hemiboreal mainland (taiga biome). Some reports of C. neesiana from the Far East [13] may be erroneous. The typical C. neesiana has leaf cells elongated along the margin, whereas C. subalpina has longer and wider leaf margin cells in intramarginal rows. These cells sometimes appear as a rim of slightly swollen cells and resembles the rim in C. marginella Mitt., although the great variation in this parameter in C. subalpina should be noted. Another distinguishing feature of C. subalpina is common subrotund underleaves versus constantly transversely ellipsoidal underleaves in C. neesiana. The photograph from this type of specimen is provided in [1]. The specimen published in Bryophyta Selecta Exsiccata №1293 under C. neesiana subsp. subalpina (see Table 1 for the specimens examined) molecularly does not belong to the C. subalpina-neesiana complex and rather belongs to the C. tosana-yoshinagana group.
3.4. On the Complex Calypogeia neogaea (R.M. Schust.) Bakalin-C. kamchatica Bakalin, Troizk. et Maltseva-C. fissa (L.) Raddi
Calypogeia fissa subsp. neogaea R.M. Schust. was segregated from C. fissa s. str. by Schuster to place the North American populations of the taxon [9]. Later, Bakalin [14] raised its rank to the species C. neogaea (R.M. Schust.) Bakalin and recorded it from the Kamchatka Peninsula, where the species was estimated to be confined to very special habitats: whole-year warm (due to thermal activity of neighboring volcanoes) mesotrophic mires. After that record, the taxon was recorded several times in the Russian Far East [15], with the vast majority of localities within thermal habitats. The species status of C. neogaea was accepted in [16], although one year before, in the World Liverwort Checklist [17], it was treated as a subspecies. The present molecular genetic data have shown the following: (1) C. neogaea in North America is a taxon distinct from C. fissa at the species level, (2) the populations from the Russian Far East are not the same as those of C. neogaea and (3) the new species (mostly confined to thermal habitats in the Russian Far East) should be segregated. The latter is described here under C. kamchatica, which is distanced from other congeners in Figure 1, Figure 4 and Figure 5 and forms a clade with two accessions of C. azurea. Moreover, Calypogeia kamchatica is not closely related to C. tosana genetically despite its similar morphology. In fact, there are five taxa that are very similar morphologically: C. fissa, C. kamchatica, C. neogaea, C. tosana (Steph.) Steph. and C. yoshinagana Steph. Calypogeia yoshinagana is discussed below, while the morphological differences between the remaining four are minor and are mostly confined to the differences in the apical part of the leaves and underleaves. C. tosana commonly has shortly bifid leaves and bisbifid underleaves, while C. fissa, C. neogaea and C. kamchatica have acute leaf apices (rarely short bidentate, other than in C. fissa, which has great variation) and commonly bifid underleaves, although commonly with a blunt tooth at one or both lateral sides (underleaves are rarely short bisbifid). The most prominent differences are in the distribution of these four taxa. Calypogeia kamchatica is confined to the Amphi-Pacific part of the Russian Far East. Although not all records are from thermal habitats, the species is the most common (if not the only one occurring) in thermal warm mires across the Russian part of the Pacific Ring of Fire (Kamchatka plus Kuril Islands) and thermal mires in Sakhalin Island. Calypogeia kamchatica is formally distributed from subarctic to boreal zones, although these definitions are ‘senseless’ if the species occurs in thermal mesotrophic mires where the substrate temperature is warm all year round and mires possess intrazonal characteristics. Calypogeia tosana is distributed more southward, starting from the southern part of the Russian Far East (Kunashir Island and the southern flank of the Primorsky Territory) and spreads across Korea, Japan and East China to North Indochina. The species does not occur in the mesotrophic mires (which may be due to the rarity of this habitat type southward of the 40th latitude). In contrast, it is mostly confined to habitats with disturbed vegetation cover (including roadsides and steep crumbling slopes to watercourses) and is rarely observed on decaying wood, humus and litter in steep slopes in forests. Calypogeia fissa possesses an ecology similar to C. tosana and is restricted to Europe, while (the data are somewhat incomplete and may be questionable) C. neogaea is restricted to North America.
3.5. On Calypogeia tosana (Steph.) Steph. and C. yoshinagana Steph.
The closest relative of Calypogeia tosana is C. yoshinagana. The latter taxon was neglected for a long time since Hattori [18] synonymized it with C. tosana. This point of view was followed in the World Liverwort Checklist [17]. Dissimilar to those latter views, C. yoshinagana was treated as a distinct species by Bakalin et al. [1] and listed in Korea by Choi et al. [19]. Calypogeia tosana and C. yoshinagana form a well-supported clade in the phylogenetic trees and are indeed quite similar morphologically, although they may be distinguished by the leaf apex that is commonly bifid in C. tosana and mostly undivided in C. yoshinagana. In addition, C. yoshinagana is characterized by (1) slightly smaller cells not exceeding 40 μm in the midleaf, although midleaf cells in C. tosana sometimes reach 50 μm wide, and (2) a higher undivided zone in the underleaves, which commonly reach two cells high, versus one cell high in well-developed C. tosana. The ecology of the two species is somewhat similar, although most accessions of C. yoshinagana are from higher elevations (cool temperate and hemiboreal belts in the mountains), while C. tosana, with a few exceptions, is mostly distributed in warm-temperate to subtropical zones (and corresponding belts) and is somewhat confined to the lowlands.
3.6. A New Calypogeia Species from California
The study of the small liverwort collection provided by J. Shevock (CAS) and collected in California (U.S.A.) revealed small Calypogeia occupying a morphologically intermediate position between the pair Calypogeia yoshinagana-C. tosana and the group Asperifolia arguta-A. indosinica. The processing of the specimen for molecular analysis revealed its strong difference from both groups (Figure 1, Figure 4 and Figure 5). The new species named Calypogeia shevockii occupies a basal position in a clade containing most Calypogeia with low support on the trnG phylogenetic tree and a central node on the trnG haplotype network (Figure 2). On the trnL–F and ITS2 trees, its position is variable, being closest to C. kamchatica and C. azurea or C. tosana and C. fissa. The species morphologically resembles small-sized, pale-colored C. yoshinagana, although it has smaller, slightly more deeply divided underleaves, a commonly bifid leaf apex and pale coloration. These features may lead to its similarity with C. tosana and C. fissa (the specimen was originally identified by us as the latter taxon), as those species differ in their smaller size and dull (not translucent) plants. The range of morphological variation in the species is certainly poorly understood since only one specimen is known. Other morphologically similar species are Asperifolia indosinica and A. arguta, from which the new species differs in its smooth leaf cuticle, outer cells in the stem cross section similar to those inward (versus outer cells distinctly larger in Asperifolia) and smaller leaf cells. Unfortunately, the inconsistent results obtained for different genes do not permit us to describe the relationships of C. shevockii more definitely.
3.7. On Calypogeia japonica Steph.
On the trnG tree, C. japonica is included in a basal clade containing six other species but separated from them with maximum support by a long branch (Figure 1). This species occupied a basal position to all other Calypogeia on the trnL–F tree (Figure 4). Calypogeia japonica is very distinct from other Calypogeia due to biconcentric oil bodies that are not known in other taxa of the genus. In the absence of oil bodies, the species may be mistaken for a morphologically similar species, C. muelleriana, due to its rounded to obtuse leaf apices and distinctly divided underleaves (although far less deeply as in C. tosana and its morphological relatives). Calypogeia muelleriana is widely distributed in the North Holarctic (one of the most common taxa in North Europe), although it is quite rare in NE Asia and does not appear to occur southward of the 50th latitude in hemiboreal and temperate Pacific Asia. In contrast, C. japonica occurs southward of the 45–47th latitudes in the insular part (South Kurils plus Japan) and from the Korean Peninsula in the continental mainland to North Indochina. However, presumably, we estimate that the area of C. japonica spreads northwards by the islands in the North Pacific until North Kurils and even probably to the Commander Archipelago, where the study of fresh material is strongly required to properly identify the specimens. Other features are minor and qualitative: C. japonica has more or less translucent shoots and wavy leaves in comparison to the opaque and more rigid shoots of C. muelleriana.
3.8. On Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk.
This species occupies a sister position to the abovementioned clade with or without the C. subalpina-C. neesiana complex on trnG and trnL–F trees, although it has quite a different position among Calypogeia vietnamica and C. granulata on the ITS2 tree (Figure 1, Figure 4 and Figure 5). Calypogeia pseudocuspidata is characterized by distinct morphology. It somewhat resembles C. cuspidata with its relatively narrow, shortly decurrent underleaves, acute to shortly bicuspidate leaf apices (although never rounded, as sometimes occurs in C. cuspidata) and the upper third of leaves turned to the ventral side of the shoot. The two species are clearly different due to larger, somewhat swollen cells along leaf (also in the underleaf, although to a lesser extent) margins, a rigid texture and a brownish color in the fresh state. Swollen cells along the leaf margin are a rare feature in the Calypogeia genus but are well pronounced in C. pseudocuspidata and C. marginella. To a lesser extent, the larger cells along the leaf margin can be observed in a suite of taxa, including C. subalpina and C. pseudointegristipula. The distribution of the taxon may be underestimated since, aside from Vietnam, it was found in the Calypogeia collection from Myanmar and may be distributed in other areas of the Sino-Himalayas.
3.9. On the Distribution of Calypogeia integristipula Steph. in the Pacific
The most unexpected record was that of the specimens named Calypogeia integristipula from the southern part of the Russian Far East, which actually belong to a previously undescribed species referred to here as C. pseudointegristipula. Therefore, the identity of specimens named C. integristipula from Pacific Asia should be questioned. Indeed, C. integristipula was described from Europe and Japan based on several specimens as indefinite syntypes [20]. Later, the taxon was lectotypified by a specimen from Germany [21], and the lectotypifacation was followed by Grolle [22]. Indeed, there are some specimens from the Russian Far East that are genetically similar to the accessions from Europe. However, these specimens arise from the continental mainland of the Far East. Two C. pseudointegristipula specimens from Sakhalin and South Kurils on trnG and trnL–F trees were placed in the same clade as “true” C. integristipula. On the ITS2 tree, the position of these species is unclear.
Morphologically, C. pseudointegristipula is similar to C. integristipula but may be distinguished by its thickened cell walls in the marginal cell rows in the leaf, distinct trigones in the leaf cells and distinctly emarginate to shortly divided underleaves. Since all specimens collected from South Kurils and the southern part of the Sakhalin Island belong to C. pseudointegristipula, we may expect its occurrence in Japan and Korea, where this species presumably may substitute for C. integristipula (the latter then remains a circumboreal taxon that does not spread to the East Asian floristic region).
3.10. On Blue Oil-Bodied Calypogeia
Deep blue oil bodies are known in several species of Calypogeia [2,7] and are easily observable when the material is fresh. The blue color of oil bodies is evident even in the field due to distinctly bluish coloration in the shoot apices. The coloration of oil bodies is due to azulene derivate production [23] and might suggest the evolutionary value of this feature and that all blue oil-bodied Calypogeia tentatively form a peculiar monophyletic group within the genus. However, it was found that blue oil-bodied Calypogeia are scattered across all phylogenetic trees; therefore, this feature might appear several times, or in contrast, the production of azulene might be suppressed in several species. Indeed, the blue oil bodies are not only found in Asperifolia and the C. pseudocuspidata-C. and integristipula-C. melleriana group and their closest relatives. To visualize their distribution across the phylogenetic tree, Calypogeia species possessing blue oil bodies are marked with asterisks in the trnG phylogenetic tree (Figure 1).
3.11. On the Genus Calypogeia in Vietnam
The last list of liverworts in Vietnam [24] contains information on eight species of Calypogeia recorded in the country in the literature (including our own papers [7] and [2,25]): C. aeruginosa Mitt., C. arguta Nees & Mont., C. azurea Stotler & Crotz, C. granulata Inoue, C. japonica Steph., C. sinensis Bakalin et Buczkovska, C. tosana (Steph.) Steph. and C. vietnamica Bakalin et Vilnet. This list should be updated as follows.
The reports of Calypogeia arguta, as shown in the present account, should be transferred to Asperifolia indosinica. True A. arguta appears to be restricted to Europe and does not occur in Asia. The first report of C. azurea in Vietnam was provided by Shu et al. [26]. The authors wrote that “Calypogeia azurea is immediately separated from the known species of Calypogeia in Vietnam by the blue oil bodies and bilobed underleaves.” (l.c.: 414). Since that publication, the species was found not to occur in Amphi-Pacific Asia, while several other species with blue oil bodies are distributed in East Asia [7]. True C. azurea seems to be restricted to Europe (probably slightly entering Siberia by dark coniferous forests). Currently, there are three species with blue oil bodies in the Vietnam flora, while the report of C. azurea in Shu et al. [26] presumably belongs to C. sinensis.
Three more species should be added to the list of Calypogeia known in Vietnam: C. apiculata, C. pseudocuspidata and C. cuspidata. The description of C. pseudocuspidata is provided in the present paper. The morphology of C. apiculata is described and illustrated in Bakalin et al. [1]. The plants we named C. apiculata in North Vietnam may not be identical to the ‘true’ C. apiculata described from Java Island. We were not able to test the populations from Java genetically. Moreover, the populations from Vietnam and China (the Chinese accession citations are in Table 1) may be identical to plants with the invalid name ‘C. gollanii’ Steph. ex Bonner, as discussed in [1]. The occurrence of C. cuspidata is even more problematic in Sino-Himalaya than that of C. apiculata. This taxon was described by Hawaii [27] and listed under Kantius cuspidatus Steph. It is questionable whether this species may have occurred in Sino-Himalaya. Moreover, there are two more names (C. confertifolia Steph. and C. hawaica Steph.) with similar descriptions from Hawaii that may be conspecific with C. cuspidata (for further discussion, see [1]). Calypogeia cuspidata is very similar morphologically to C. apiculata, which differs in its smooth cuticle (versus finely verruculose). Other differences are minor and unstable and include no or barely (versus up to 1/3 of stem width) decurrent underleaves, more densely and subimbricate (versus contiguous to somewhat distant) inserted leaves and wider (1.4 as wide as a stem versus 1.1–1.2 as wide as a stem) underleaves.
Noticeably, all reported Calypogeia taxa were found in the northern part of the country (the genus itself was first reported in Vietnam in 2017 by Shu et al. [26], based on two species records). Calypogeia likely occurs in the southern part of the country, but there are still no data to support this hypothesis.
Therefore, ten species are now known in Vietnam, and all belong to East Asian or SE Asian floral elements. Earlier [1], we provided a key to identifying all species of Calypogeia that were known and expected in Sino-Himalaya and the surrounding areas (including North Vietnam). That key certainly did not include taxa described in the present work. Moreover, it is quite complicated to use keys containing many species, with many couplets and many morphologically similar geographic vicariants. Thus, we provide an updated key to Calypogeia and Asperifolia species known in Vietnam.
3.11.1. Key to Calypogeia and Asperifolia taxa in Vietnam
1. Underleaves as large as leaves or larger, transversely ellipsoidal, with an apex entire to shallowly emarginate, oil bodies deep blue to purple and purple brown … C. aeruginosa.
1. Underleaves commonly smaller than leaves (rarely as large as leaf) and distinctly 2–4-lobed, oil bodies deep blue to colorless and brownish, never purple … 2.
2. Leaves with rounded to obtuse apex, oil bodies granulate with central eye (biconcentric) … C. japonica.
2. Leaves with acute, apiculate to bifid apex, oil bodies granulate to botryoidal, never with central eye … 3.
3. Leaf cuticle papillose to verruculose … 4.
3. Leaf cuticle smooth … 5.
4. Leaves with constantly bicuspidate apex, outer stem cells in the cross section distinctly larger than inner cells, underleaves deeply bisbifid … A. indosinica.
4. Leaves with acute (very rarely bicuspidate) apex, outer stem cells in the cross section as large as inner cells, underleaves bifid … C. apiculata.
5. Underleaves as large as leaves or smaller to 2/3 of leaf size, undivided zone in underleaf over 5–7 cells high … C. vietnamica.
5. Underleaves much smaller than leaves (never exceeding ¼ of leaf size) … 6.
6. Cells along the leaf margin commonly distinctly larger than those inward, thick-walled plants commonly brownish and brownish greenish when fresh … C. pseudocuspidata.
6. Cells along the leaf margin as large as cells inward, not swollen, with merely thin walls, plants pale greenish to greenish yellowish and bluish when fresh … 7.
7. Underleaves bifid, leaves acute, oil bodies granulate, colorless … C. cuspidata.
7. Underleaves bisbifid (rarely bifid in smaller plants), leaves bicuspidate to acute, oil bodies botryoidal (colorless) to coarsely granulate (deep blue in color) and very finely granulate (then commonly brownish) … 8.
8. Oil bodies very finely granulate, brownish to bluish brownish … C. granulata.
8. Oil bodies coarsely granulate to botryoidal, colorless to deep blue … 9.
9. Oil bodies botryoidal, colorless, leaves almost constantly bicuspidate, underleaves deeply bisbifid … C. tosana.
9. Oil bodies coarsely granulate, deep blue, leaf apex acute to bicuspidate, underleaves deeply to more shortly bisbifid … C. sinensis.
3.11.2. Annotated List of Calypogeia and Asperifolia taxa in Vietnam
Below, we provide a list of Calypogeia and Asperifolia species known in Vietnam that have specimens examined and corresponding references to recent descriptions and illustrations. The specimens examined are limited to one for each locality where the species was recorded. The newly described species are listed but not annotated.
Asperifolia indosinica Troizk. et Bakalin, the present paper.
Calypogeia aeruginosa Mitt., J. Proc. Linn. Soc., Bot. 5 (18): 107, 1860 [1861].
Basionym: Kantius aeruginosus (Mitt.) Steph., Hedwigia 34: 55, 1895.
Type: India, Sikkim, 12,000 ped. alt. (4000 m a.s.l.), J.D. Hooker, no. 1319 (isotype: G [G00064244/5286!]).
Descriptions in [28].
Specimens examined: Vietnam, Lao Cai Province, Hoang Lien Range, Hoang Lien National Park, Phan Xi Pan Peak Area (22°18′15″ N 103°46′30″ E), 3050 m a.s.l., 20 April 2017, V.A. Bakalin & K.G. Klimova V-8-36-17 (VBGI), main path to the Phan Xi Pan Peak (22°18′46″ N 103°45′51″ E), 2860 m a.s.l., 22 April 2017, V.A. Bakalin & K.G. Klimova V-11-12-17 (VBGI), (22°18′28″ N 103°46′25″ E), 2846 m a.s.l., 3 April 2018, V.A. Bakalin & K.G. Klimova V-17-14-18 (VBGI).
Ecology: Open to partly shaded moist cliffs, including those near streams in oro-subtropical forests with some warm-temperate floral elements with rocky outcrops.
Calypogeia apiculata (Steph.) Steph., Bull. Herb. Boissier (sér. 2) 8 (9): 668 (400), 1908.
Basionym: Kantius apiculatus Steph., Hedwigia 34 (2): 51, 1895.
Type: Java, Prof. Stahl (lectotype (designated in [1]): G [G00061103!]).
Descriptions in [1].
Specimens examined: Vietnam, Lao Cai Province, Hoang Lien Son Range (22°25′14″ N 103°46′46″ E), 1325 m a.s.l., 16 April 2017, V.A. Bakalin & K.G. Klimova V-1-34-17 (VBGI), (22°23′54″ N 103°47′07″ E), 1410 m a.s.l., 16 April 2017, V.A. Bakalin & K.G. Klimova V-2-11-17 (VBGI), Hoang Lien National Park (22°21′20″ N 103°47′33″ E), 1520 m a.s.l., 17 April 2017, V.A. Bakalin & K.G. Klimova V-3-14-17 (VBGI), one of the ways to the Phan Xi Pan Peak (22°19′35″ N 103°46′57″ E), 2210 m a.s.l., 19 April 2017, V.A. Bakalin & K.G. Klimova V-5-71-17 (VBGI), Hoang Lien National Park (22°20′58″ N 103°45′49″ E), 1840 m a.s.l., 21 April 2017, V.A. Bakalin & K.G. Klimova V-10-28-17 (VBGI), southern slope of Phan Xi Pan Peak (22°18′32″ N 103°46′44″ E), 2670 m a.s.l., 4 April 2018, V.A. Bakalin & K.G. Klimova V-19-27-18 (VBGI); Vietnam, Lai Châu Province, Pu Ta Leng Mt. Range (22°25′33″ N 103°34′16″ E), 1703 m a.s.l., 26 March 2018, V.A. Bakalin & K.G. Klimova V-3-9-18 (VBGI), (22°24′56″ N 103°35′47″ E), 2347 m a.s.l., 27 March 2018, V.A. Bakalin & K.G. Klimova V-7-8-18 (VBGI), Banh Hang Stream valley (22°30′09.3″ N 103°33′15.6″ E), 1356 m a.s.l., 4 April 2019, V.A. Bakalin & K.G. Klimova V-2-5-19 (VBGI), (22°30′09.8″ N 103°34′36.0″ E), 2200-2300 m a.s.l., 5 April 2019, V.A. Bakalin & K.G. Klimova V-3-4-19 (VBGI), (22°29′53.5″ N 103°33′55.0″ E), 1582 m a.s.l., 8 April 2019, V.A. Bakalin & K.G. Klimova V-15-5-19 (VBGI).
Ecology: Open to partly shaded moist cliffs and boulders, including those near streams in oro-subtropical forests, rarely scattered Abies delavayi stands with Rhododendron trees and Sinobambusa thickets in the understorey.
Calypogeia cuspidata (Steph.) Steph., Bull. Herb. Boissier (sér. 2) 8 (9): 669 (401), 1908.
Basionym: Kantius cuspidatus Steph., Bull. Herb. Boissier 5 (10): 846, 1897.
Type: Hawaii, Heller 2308 (lectotype (designated in [1]): G [G00069713!].
Descriptions in [1].
Specimens examined: Vietnam, Cao Bằng Province, Phia Oac–Phia Den National Park (22°36.818′N 105°52.148′E), 1772 m a.s.l., 26 March 2020, V.A. Bakalin & K.G. Klimova, V-23-13-20 (VBGI).
Ecology: Open moist cliffs in oro-subtropical forests with dense bamboo understorey.
Calypogeia granulata Inoue, J. Jap. Bot. 43 (10/11): 468, 1968.
Type: Japan, Saitama Prefecture, Kuroyama, 500 m a.s.l., 24 June 1968, H. Inoue, 18004 (holotype: TNS [174361!]; isotype: G [G00114896!]).
Specimens examined: Vietnam, Lao Cai Province, Hoang Lien Range (22°23′54″ N 103°47′07″ E), 1410 m a.s.l., 16 April 2017, V.A. Bakalin & K.G. Klimova V-2-10-17 (VBGI), Hoang Lien Range, Hoang Lien National Park (22°21′20″ N 103°47′33″ E), 1520 m a.s.l., 17 April 2017, V.A. Bakalin & K.G. Klimova V-3-83-17 (VBGI), (22°20′55″ N 103°46′03″ E), 1700–1900 m a.s.l., 15 March 2016, V.A. Bakalin V-1-16-16 (VBGI), one of the ways to the Phan Xi Pan Peak (22°19′10″ N 103°47′17″ E), 2030 m a.s.l., 18 April 2017, V.A. Bakalin & K.G. Klimova V-4-1-17 (VBGI), (22°19′35″ N 103°46′57″ E), 2210 m a.s.l., 19 April 2017, V.A. Bakalin & K.G. Klimova V-5-59-17 (VBGI), main path to the Phan Xi Pan Peak (22°20′10″ N 103°46′46″ E), 2060 m a.s.l., 19 April 2017, V.A. Bakalin & K.G. Klimova V-6-6-17 (VBGI), Phan Xi Pan Peak Area (22°18′15″ N 103°46′30″ E), 3050 m a.s.l., 20 April 2017, V.A. Bakalin & K.G. Klimova V-8-67-17 (VBGI), Hoang Lien National Park (22°20′58″ N 103°45′49″ E), 1840 m a.s.l., 21 April 2017, V.A. Bakalin & K.G. Klimova V-10-13-17 (VBGI), main path to the Phan Xi Pan Peak (22°19′12″ N 103°46′11″ E), 2610 m a.s.l., 22 April 2017, V.A. Bakalin & K.G. Klimova V-12-5-17 (VBGI), Lai Châu Province, Pu Ta Leng Mt. Range (22°24′56″ N 103°35′47″ E), 2347 m a.s.l., 27 March 2018, V.A. Bakalin & K.G. Klimova V-7-52-18 (VBGI), Banh Hang Stream valley (22°30′09.8″ N 103°34′36.0″ E), 2200–2300 m a.s.l., 5 April 2019, V.A. Bakalin & K.G. Klimova V-3-4-19 (VBGI), S-facing slope of Bach Moc Luong Tu Mt. (22°30′10.0″ N 103°35′06.5″ E), 2800–2900 m a.s.l., 6 April 2019, V.A. Bakalin & K.G. Klimova V-8-4-19 (VBGI), Banh Hang Stream valley (22°30′02.7″ N 103°34′18.7″ E), 2022 m a.s.l., 7 April 2019, V.A. Bakalin & K.G. Klimova V-13-8-19 (VBGI), Sơn La Province, Xuan Nha Nature Reserve, area of Long Sap Army Gate, NW-facing slope of Dinh Pha Luong Mt. (20°40′28.9″ N 104°37′53.6″ E), 1700–1800 m a.s.l., 11 April 2019, V.A. Bakalin & K.G. Klimova V-21-16-19 (VBGI), area of Long Sap Army Gate (20°40′53.4″ N 104°38′18.9″ E), 1500 m a.s.l., 12 April 2019, V.A. Bakalin & K.G. Klimova V-24-17-19 (VBGI), Hà Giang Province, Tay Con Linh Range, Tay Con Linh Nature Reserve (22°47′47.7″ N 104°48′53.4″ E), 1990 m a.s.l., 21 March 2020, V.A. Bakalin & K.G. Klimova V-9-16-20 (VBGI), (22°47′50.3″ N 104°48′40.9″ E), 2191 m a.s.l., 21 March 2020, V.A. Bakalin & K.G. Klimova V-11-3-20 (VBGI), area near Tay Con Linh Mt. top (22°48′06.7″ N 104°48′22.7″ E), 2423 m a.s.l., 22 March 2020, V.A. Bakalin & K.G. Klimova V-14-15-20 (VBGI), Cao Bằng Province, Phia Oac–Phia Den National Park (22°36.502′N 105°52.270′E), 1573 m a.s.l., 25 March 2020, V.A. Bakalin & K.G. Klimova V-21-15-20 (VBGI), Lạng Sơn Province, Mau Son mountain area, Phia Po Mt. top (21°50′10.2″ N 106°57′39.6″ E), 1537 m a.s.l., 31 March 2020, V.A. Bakalin & K.G. Klimova V-31-2-20 (VBGI).
Ecology: Open to partly shaded mesic to moist cliffs and their crevices, fine soil along streams and trails, living and decaying tree trunks in oro-subtropical forests, commonly with a dense bamboo understorey.
Calypogeia japonica Steph., Sp. Hepat. (Stephani) 6: 448, 1924.
Type: Japan, “Japonia, Uematsu” (neotypified by Furuki and Ota [30]: G [G00047413/9720!]).
Specimens examined: Vietnam, Lao Cai Province, Hoang Lien Son Range (22°25′14″ N 103°46′46″ E), 1325 m a.s.l., evergreen south subtropical mountain forest in stream valley, open moist cliff near stream, 16 April 2017, V.A. Bakalin & K.G. Klimova, V-1-31-17 (VBGI).
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., the present paper.
Calypogeia sinensis Bakalin & Buczk. PLoS ONE 13(10): e0204561 [7], 2018.
Type: China, Guizhou Province, Duyun Municipality (26°22.383′N, 107°21.35′E), 1300 m a.s.l., 22 November 2013, V.A. Bakalin, China-56-77-13 (holotype: VBGI!; isotype: POZW!).
Descriptions in [7].
Specimens examined: Vietnam, Lao Cai Province, Hoang Lien Range, Hoang Lien National Park, one of the ways to the Phan Xi Pan Peak (22°19′35″ N 103°46′57″ E), 2210 m a.s.l., 19 April 2017, V.A. Bakalin & K.G. Klimova V-5-24-17 (VBGI), Lai Châu Province, Pu Ta Leng Mt. summit (22°25′22″ N 103°36′14″ E), 3050 m a.s.l., 30 March 2018, V.A. Bakalin & K.G. Klimova V-11-25-18 (VBGI), Pu Ta Leng Mt. Range (22°24′28″ N 103°36′37″ E), 2394 m a.s.l., 30 March 2018, V.A. Bakalin & K.G. Klimova V-13-3-18 (VBGI), Lao Cai Province, Hoang Lien Range, Hoang Lien National Park, area near Phan Xi Pan Peak (22°18′13″ N 103°46′32″ E), 3105 m a.s.l., 3 April 2018, V.A. Bakalin & K.G. Klimova V-18-17-18 (VBGI), Hoang Lien National Park (22°20′22.6″ N 103°46′40.2″ E), 2014 m a.s.l., 5 April 2018, V.A. Bakalin & K.G. Klimova V-21-23-18 (VBGI), Hanoi Capital Province, Ba Vi National Park (21°03′39″ N 105°21′47″ E), 1072 m a.s.l., 8 April 2018, V.A. Bakalin V-22-7-18 (VBGI), Sơn La Province, Xuan Nha Nature Reserve, area of Long Sap Army Gate, NW-facing slope of Dinh Pha Luong Mt. (20°40′28.9″ N 104°37′53.6″ E), 1700–1800 m a.s.l., 11 April 2019, V.A. Bakalin & K.G. Klimova V-21-26-19 (VBGI), Xuan Nha Nature Reserve, area of Long Sap Army Gate (20°41′11.5″ N 104°37′25.8″ E), 1200–1300 m a.s.l., 12 April 2019, V.A. Bakalin & K.G. KlimovaV-23-15-19 (VBGI), (20°40′53.4″ N 104°38′18.9″ E), 1500 m a.s.l., 12 April 2019, V.A. Bakalin & K.G. Klimova V-24-12-19 (VBGI), Hà Giang Province, Tay Con Linh Range, Tay Con Linh Nature Reserve (22°47′43.0″ N 104°49′16.2″ E), 1672 m a.s.l., 20 March 2020, V.A. Bakalin & K.G. Klimova V-5-7-20 (VBGI), (22°47′47.7″ N 104°48′53.4″ E), 1990 m a.s.l., 21 March 2020, V.A. Bakalin & K.G. Klimova V-9-20-20 (VBGI), (22°47′50.3″ N 104°48′40.9″ E), 2191 m a.s.l., 21 March 2020, V.A. Bakalin & K.G. Klimova V-11-7-20 (VBGI), Cao Bằng Province, Phia Oac–Phia Den National Park (22°36.502′N 105°52.270′E), 1573 m a.s.l., 25 March 2020, V.A. Bakalin & K.G. Klimova V-21-12-20, V-21-26-20 (VBGI), (22°36.443′N 105°52.039′E), 1691 m a.s.l., 26 March 2020, V.A. Bakalin & K.G. Klimova V-24-7-20 (VBGI), (22°36′52.6″ N 105°52′05.3″ E), 1796 m a.s.l., 27 March 2020, V.A. Bakalin & K.G. Klimova V-26-5-20, V-26-17a-20 (VBGI), (22°36′30.2″ N 105°52′08.4″ E), 1593 m a.s.l., 28 March 2020, V.A. Bakalin & K.G. Klimova V-27-4-20 (VBGI).
Ecology: Open to partly shaded moist boulders and cliffs (also covered with fine soil), including those near streams, moist trunks of living and decaying tree trunks, rarely clayish soil on steep slopes, in oro-subtropical and, rarely, tropical forests.
Calypogeia tosana (Steph.) Steph., Bull. Herb. Boissier (sér. 2) 8 (9): 678 (410), 1908.
Type: Japan, Tosa Makino (LECTOTYPE (designated here): G [G00047274/26013, packet b!]).
Descriptions in [1].
Specimens examined: Vietnam, Lao Cai Province, Hoang Lien Range, Hoang Lien National Park, (22°20′55″ N 103°46′03″ E), 1700–1900 m a.s.l., 15 March 2016, V.A. Bakalin V-1-16-16 (VBGI), (22°21′20″ N 103°47′33″ E), 1520 m a.s.l., 17 April 2017, V.A. Bakalin & K.G. Klimova V-3-73-17 (VBGI), Hoang Lien National Park, Phan Xi Pan Peak Area (22°18′15″ N 103°46′30″ E), 3050 m a.s.l., 20 April 2017, V.A. Bakalin & K.G. Klimova V-8-64-17 (VBGI), southern slope of Phan Xi Pan Peak (22°18′32″ N 103°46′44″ E), 2670 m a.s.l., 4 April 2018, V.A. Bakalin & K.G. Klimova V-19-11-18 (VBGI), Hanoi Capital Province, Ba Vi National Park (21°03′39″ N 105°21′47″ E), 1072 m a.s.l., 8 April 2018, V.A. Bakalin V-22-8-18 (VBGI), Lai Châu Province, Banh Hang Stream valley (22°30′00.38″ N 103°33′29.98″ E), 1509 m a.s.l., 8 April 2019, V.A. Bakalin & K.G. Klimova V-16-2-19 (VBGI), Cao Bằng Province, Phia Oac–Phia Den National Park (22°36.818′N 105°52.148′E), 1772 m a.s.l., 26 March 2020, V.A. Bakalin & K.G. Klimova V-23-2-20, V-23-16-20 (VBGI).
Ecology: Open moist cliffs near watercourses to (more frequently) clayish soil in steep slopes, stream banks and trails in oro-subtropical forests.
Calypogeia vietnamica Bakalin et Vilnet Herzogia 32 (1): 225, 2019.
Type: Vietnam, Lao Cai Province, SaPa District, San Sa Ho Commune, Hoang Lien Range, Phan Xi Pang Peak area (22°18.45′N, 103°46.567′E), 2900 m a.s.l., 20 April 2017, V.A. Bakalin & K.G. Klimova, V-9-23-17 (holotype: VBGI!).
Descriptions in [2].
Illustrations in [1] (Figures 3 and 4).
Specimens examined: Vietnam, Lao Cai Province, Hoang Lien Son Range, Hoang Lien National Park, Phan Xi Pan Peak Area (22°18′15″ N 103°46′30″ E), 3050 m a.s.l., 20 April 2017, V.A. Bakalin & K.G. Klimova V-8-48-17 (VBGI), (22°18′27″ N 103°46′34″ E), 2900 m a.s.l., 20 April 2017, V.A. Bakalin & K.G. Klimova V-9-23-17 (VBGI), Lai Châu Province, Pu Ta Leng Mt. summit (22°25′22″ N 103°36′14″ E), 3050 m a.s.l., 30 March 2018, V.A. Bakalin & K.G. Klimova V-11-45-18 (VBGI), the ridge line (22°25′18″ N 103°36′26″ E), 2930 m a.s.l., 30 March 2018, V.A. Bakalin & K.G. Klimova V-12-10-18, Pu Ta Leng Mt. Range (22°24′28″ N 103°36′37″ E), 2394 m a.s.l., 30 March 2018, V.A. Bakalin & K.G. Klimova V-13-3-18 (VBGI), Lao Cai Province, Hoang Lien Son Range, Hoang Lien National Park, area near Phan Xi Pan Peak (22°18′13″ N 103°46′32″ E), 3105 m a.s.l., 3 April 2018, V.A. Bakalin & K.G. Klimova V-18-18-18 (VBGI).
Ecology: Open to partly shaded moist cliffs, including those near streams, moist humus on steep slopes, moist trunk bases in part shade in oro-subtropical forests and dense communities composed of Sinobambusa and Rhododendron.
3.12. On the Genus Calypogeia in Myanmar
The liverwort flora of Myanmar is poorly known. To date, no member of Calypogeia has been reported from Myanmar.
In the course of biodiversity transect studies along elevational gradients in Myanmar from 2012–2014 (Mt Victoria, Natma Taung National Park, Chin State; Hponyin Razi and Hponkan Razi NW of Putao, Kachin State), Georg Miehe and his colleagues collected an extensive number of bryophyte specimens. This material was sent to F. Müller for further processing and identification.
Among the specimens that were found, at least five species of Calypogeia s.l. in the collections were not ‘fresh’, thus the study of the oil bodies was not possible. Only in one specimen (J. Kluge & P.K. Kine 14-026-043a-H) were remnants of oil bodies observed, and the blue color was distinctive. All recorded Calypogeia specimens were gathered in upper elevations of the mountains at 2000–3588 m.
The following species are represented in the material and all of them represent first records for Myanmar: Asperifolia indosinica Bakalin et Troizk., Calypogeia lunata Mitt., Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., Calypogeia tosana (Steph.) Steph., and Calypogeia vietnamica Bakalin et Vilnet.
Specimens examined:
Asperifolia indosinica Bakalin et Troizk.: Myanmar, Hponyin Razi, (27°36′25.2″ N 96°59′03.7″ E) 2039 m a.s.l., Lithocarpus-Magnolia forest, 12 November 2013, G. Miehe et al. 13-091-144 (DR).
Calypogeia lunata Mitt.: Myanmar, Hponyin Razi (27°37′34.8″ N 96°58′40.1″ E) 3016 m a.s.l., upper montane Abies-Rhododendron forest, 25 October 2013, G. Miehe et al. 13-070-044-B (DR), (27°37′32.4″ N 96°58′40.4″ E) 3010 m a.s.l., upper montane Abies-Rhododendron forest, 25 October 2013, G. Miehe et al. 13-071-043-B (DR), (27°36′51.5″ N 96°58′55.4″ E) 2433 m a.s.l., Magnolia-Fagaceae-bamboo forest, 03 November 2013, G. Miehe et al. 13-083-074-D (DR), (27°36′46.6″ N 96°58′54.5″ E) 2371 m a.s.l., Magnolia-Fagaceae-bamboo forest, 02 November 2013, G. Miehe et al. 13-081-094-G (DR, VBGI), mixed with C. pseudocuspidata.
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., see the information in the description of the species in the present paper.
Calypogeia tosana (Steph.) Steph.: Myanmar, Hponyin Razi (27°36′22.3″ N 96°59′04.7″ E) 2039 m a.s.l., Lithocarpus-Magnolia forest, 10 November 2013, G. Miehe et al. 13-089-142-B (DR).
Calypogeia vietnamica Bakalin et Vilnet: Myanmar, Kachin State, Hponkan Razi (27°30′21.3″ N 96°56′06.8″ E) 3588 m a.s.l., evergreen broadleaved forest, 11 November 2014, J. Kluge & P.K. Kine 14-026-043a-H (DR).
4. Taxonomic Treatment
The treatment includes two groups of taxa: (1) taxa newly described in the present paper and (2) taxa whose classification should be clarified in light of newly obtained data.
Asperifolia (Warnst.) Troizk., Bakalin, Maltseva, comb. nov.
Basionym: Calypogeia [unranked] Asperifoliae Warnst., Bryol. Z. 1 (7): 111, 1917 (=Calypogeia subg. Asperifolia (Warnst.) R.M. Schust., Hepat. Anthocerotae N. Amer. 2: 115, 1969)
Type of species: Asperifolia arguta (Nees et Mont.) Troizk., Bakalin et Maltseva, comb. nov.
Basionym: Calypogeia arguta Nees et Mont., Naturgesch. Eur. Leberm. 3: 24, 1838.
Other taxa: Asperifolia indosinica (see below); Asperifolia sullivantii (Austin) Troizk., Bakalin et Maltseva, comb. nov. Basionym: Calypogeia sullivantii Austin, Hepat. bor.-amer.: 19, 1873.
Asperifolia indosinica Bakalin et Troizk. sp. nov.
Description. Plants are soft, greenish to whitish greenish, greatly varying in size, in loose patches, creeping, loosely attached to the substratum and 10–20 mm long and 0.8–0.4 mm wide. Rhizoids virtually absent or very few. Stem cross section transversely ellipsoidal, 100–120 μm high and 150–170 μm wide, outer cells larger than inner, 22–35 μm in diameter, in the dorsal side with thicker walls, inner cells 20–30 μm in diameter, with slightly thickened walls, trigones small concave. Leaves subhorizontally inserted, contiguous to somewhat distant, nearly plane, not decurrent dorsally, shortly, but clearly decurrent ventrally, when flattened in the slide widely ovate, well-developed 500–600 μm long and 400–700 μm wide (larger leaves commonly wider than longer), bifid, divided by U-shaped sinus into two prominently acute lobes, terminating by 1–3 superposed cells. Underleaves obliquely spreading, 1.1–1.5 times wider than the stem (smaller may be narrower than the stem) when looking in alive material, barely decurrent, deeply bisbifid (smaller may be simply bifid), undivided zone 1–2 cells high, rhizogenous area not developed or as 1–2 rows of smaller cells, in the slide 100–200 μm wide and 50–150 μm long. Midleaf cells greatly varying in size, (25–)30–50(–60) μm in diameter, with thin walls and vestigial concave trigones, cuticle finely papillose; cells along the margin oblong to subquadrate, 32–58 μm long and 25–38 μm wide, thin-walled, trigones very small, concave and cuticle finely verruculose to nearly smooth.
Holotype: Vietnam, Lai Châu Province, Hoang Lien Range, Hoang Lien National Park (22°20′55″ N 103°46′03″ E), 1700–1900 m a.s.l., moist cliffs in evergreen south subtropical mountain forest in deep valley, 15 March 2016, V.A. Bakalin, V-1-112-16 (VBGI).
Other specimens examined (paratypes): Vietnam, Lai Châu Province, Hoang Lien Range, Hoang Lien National Park (22°20′55″ N 103°46′03″ E), 1700–1900 m a.s.l., moist cliffs in evergreen south subtropical mountain forest in deep valley, 15 March 2016, V.A. Bakalin V-1-12-16 (VBGI), Lao Cai Province, Hoang Lien Range, Hoang Lien National Park (22°21′20″ N 103°47′33″ E), 1520 m a.s.l., evergreen south subtropical mountain forest in deep valley, partly shaded moist cliff crevice, 17 April 2017, V.A. Bakalin & K.G. Klimova V-3-14-17 (VBGI), Lai Châu Province, Pu Ta Leng Range (22°24′56″ N 103°35′47″ E), 2347 m a.s.l., partly shaded moist clayish trail cut on slope in evergreen south subtropical mountain forest in stream valley, 27 March 2018, V.A. Bakalin & K.G. Klimova V-7-58-18 (VBGI), Lao Cai Province, Hoang Lien Range, Hoang Lien National Park, southern slope of Phan Xi Pan Peak (22°18′32″ N 103°46′44″ E), 2670 m a.s.l., scattered Abies delavayi with many rhododendron trees and Sinobambusa in narrow valley, partly shaded moist clayish soil on steep slope, 4 April 2018, V.A. Bakalin & K.G. Klimova V-19-10-18 (VBGI), Lai Châu Province, Banh Hang Stream valley (22°30′00.38″ N 103°33′29.98″ E), 1509 m a.s.l., wide valley in evergreen south subtropical mountain forest, steep slope to trail, open moist clayish soil in trail cut, 8 April 2019, V.A. Bakalin & K.G. Klimova V-16-3-19 (VBGI), Sơn La Province, Xuan Nha Nature Reserve, area of Long Sap Army Gate, bottom of Dinh Pha Luong Mt. (20°41′00.9″ N 104°37′28.5″ E), 1200–1400 m a.s.l., somewhat disturbed tropical forest with the trail across steep rocky slope with sandstone enriched with calcium carbonate, partly shaded moist clayish soil in trail cut, 11 April 2019, V.A. Bakalin & K.G. Klimova V-19-9-19 (VBGI), Hà Giang Province, vicinity of Lung Tao Village, Tay Con Linh Range, Tay Con Linh Nature Reserve (22°47′30.3″ N 104°49′28.5″ E), 1503 m a.s.l., evergreen south subtropical mountain forest on SE-facing slope, open moist clayish trail cut, 20 March 2020, V.A. Bakalin & K.G. Klimova V-2-2-20 (VBGI), (22°47′50.3″ N 104°48′40.9″ E), 2191 m a.s.l., evergreen south subtropical mountain forest on SE-facing slope, partly shaded moist clayish soil near stream, 21 March 2020, V.A. Bakalin & K.G. Klimova V-11-36-20 (VBGI).
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., sp. nov.
Description. Plants are prostrate, green when fresh and brown in the herbarium, 1.4–2.5 mm wide and 10–30 mm long, rigid, loosely attached to the substratum, forming loose patches. Rhizoids nearly absent or very rare, colorless to brownish. Stem cross section transversely ellipsoidal, 140–250 μm high and 200–350 μm wide, outer walls thin, radial walls thinner than external, inward cell walls become thicker, in outer layer 25–30 μm in diameter, inward cells larger, to 50 μm in diameter, with small, sometimes indistinct trigones. Leaves contiguous to subimbricate (overlapping to 1/3 of above situated leaf), obliquely inserted, convex, with apex turned ventrally, when flattened in the slide widely ovate to triangular ovate, well-developed 900–1300 μm long and 700–1200 μm wide (larger leaves are wider than longer), not decurrent dorsally and not or slightly ventrally, apex acute to acuminate and rarely short bicuspidate (then divided by small, U-shaped sinus). Underleaves obliquely spreading, 1.1–1.3 of stem width, shortly decurrent, divided by widely V- to U-shaped sinus into two lobes with or without additional teeth (in the vast majority of cases additional teeth very obscure or absent), undivided zone 2–4 cells high, rhizogenous area not developed or as 1–2 rows of small cells. Cells in the midleaf subisodiametric, 32–74 × 24–40 μm, thin-walled, with small but distinct concave trigones, cuticle smooth; cells along the margin are much larger than inward, 45–79 μm long and 25–41 μm wide, with thickened cell walls and noticeable thick external wall and cuticle is smooth throughout.
Holotype: Vietnam, Lao Cai Province, Sa Pa District, San Sa Ho Commune, Hoang Lien Range, Hoang Lien National Park, open moist cliff near stream in south subtropical forest in the stream valley near waterfall (22°20′22.6″ N 103°46′40.2″ E), 2014 m a.s.l., 5 April 2018, V.A. Bakalin & K.G. Klimova, V-21-17-18 (VBGI).
Other specimen examined (paratype): Myanmar, Hponyin Razi (27°36′46.6″ N 96°58′54.5″ E), 2371 m a.s.l., Magnolia-Fagaceae-bamboo forest, 02 November 2013, G. Miehe, P.K. Kine, L. Shein, M. Kyaw, P. Ma & S. Lan Wan, 13-081-094 g (DR, VBGI, HSNU).
Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva, sp. nov.
Description. Plants are more or less soft, 1.2–1.8 mm wide and 10–20 mm long, closely attached to the substratum, whitish greenish to whitish brownish, as solitary pants over Sphagnum. Rhizoids abundant, obliquely spreading, separate, brownish. Stem cross section of well-developed plants transversely ellipsoidal, ca. 200 × 300 μm, with prominently thickened walls and moderate in size, concave trigones, (13–)25–32 μm in diameter, in the ventral side commonly smaller than in the dorsal one. Leaves contiguous to subimbricate, obliquely inserted, plane to slightly convex, with apices turned to the ventral side, not decurrent dorsally and ventrally, when flattened in the slide widely ovate, well-developed leaves 800–900 × 900–1100 μm, distinctly wider than longer, apex obtuse to somewhat acute, never divided. Underleaves narrowly spreading to nearly appressed to the stem, 1.3–2.0 times wider than the stem when looking in alive material, not decurrent, in the slide transversely ellipsoidal, divided by U- to widely V-shaped sinus into two lobes, without lateral teeth, undivided zone 3–4 cells high, rhizogenous area well-developed and 4–5 rows of small cells, 300–360 × 500–600 μm. Midleaf cells with somewhat thickened cell walls and moderate in size, concave trigones, 32–58 × 32–50 μm; cells along margin subisodiametric, with thickened walls and moderate in size to large concave trigones, 35–50 × 30–38 μm; cuticle smooth throughout.
Holotype: Russia, Russian Far East, Khabarovsk Territory, Tardoki-Yani Range, ca. 1 km westward of Tardoki-Yani Mt. peak (48°53′16.9″ N 138°02′52.8″ E), 1940 m a.s.l., moist cliff crevice in open place in steep N-facing slope with cliffs, 24 August 2013, V.A. Bakalin, Kh-40-28-13 (VBGI).
Other specimen examined (paratype): Russia, Russian Far East, Khabarovsk Territory, Baidzhalsky Range, Yarap River middle course, mountain range at the right side of the river, in the upper course of Kamenistyi Stream (50°20′44″ N 134°39′42″ E), 1640 m a.s.l., N-facing cliffs at the ridge line, open moist cliff crevice, 9 August 2016, V.A. Bakalin Kh-23-2-16 (VBGI).
Comment: The species is distinct from C. sphagnicola in its contiguous to subimbricate leaves, larger leaf cell size and large, distinctly wider leaves than stem underleaves. The species is also morphologically similar to C. muelleriana, which differs in its thickened cell walls and larger trigones in the midleaf and along the leaf margin. The species is distinct among other congeners due to prominently thickened walls in the stem cross section.
Calypogeia neogaea (R.M. Schust.) Bakalin, Conserv. Biodivers. Kamchatka Coastal Waters, Proc. VII Int. Sci. Conf., Petropavlovsk-Kamchatsky, 28–29 November 2006 9, 2007.
Basionym: Calypogeia fissa subsp. neogaea R.M. Schust., Hepat. Anthocerotae N. Amer. 2: 169, 1969.
Description (based on specimen examined). Plants are pale greenish (the same in herbarium), somewhat glistening, not curly when dry, merely rigid, prostrate, in loose mats, loosely attached to the substratum, 1.6–3.0 mm wide and 15–25 mm long, in loose patches. Rhizoids abundant, erect spreading, brownish, separated. Stem cross section transversely ellipsoidal, well-developed ca 150 × 300 μm, with subequal to merely unequal thickened walls, outer cells slightly larger, 22–25 × 12–23 μm, inner cells 12–25 μm in diameter, with concave, small to vestigial trigones. Leaves obliquely to subhorizontally inserted, dorsally subtransversely inserted to arcuately inserted, concave-canaliculate, contiguous, when flattened in the slide triangular-ovate, 900–1300 × 650–1000 μm, distinctly longer than wider, apex obtuse to almost rounded, rarely bifid. Underleaves not decurrent, spreading, 1.1–1.5 times wider than the stem when looking in alive material, in the slide transversely ellipsoidal to suborbicular, 280–300 × 360–500 μm, bifid, divided by U-shaped sinus into two acute lobes, lateral additional teeth absent, unclear to distinct, although blunt, undivided zone two cells high. Midleaf cells with somewhat thickened walls, trigones small, concave, cells oblong, 45–70 × 27–38 μm; cells along margin with somewhat thickened walls, subisodiametric to oblong, with moderate in size trigones adjacent to the external side, 30–50 × 25–38 μm.
Specimen examined: U.S.A., Missouri State, Sainte Genevieve County, Hickory Canyons Natural Area, along Hickory Creek north of the loop trail (37°52′35″ N 90°18′18″ W), 300 m a.s.l., fine soil in the cave, 26 October 2014, V.A. Bakalin US-41a-77-14 (VBGI).
Illustrations in present paper: Figure 18.
Calypogeia kamchatica Bakalin, Troizk. et Maltseva, sp. nov.
Description. Plants are somewhat glistening, translucent, yellowish greenish to whitish yellowish, curly when dry, very soft, in loose mats, loosely attached to the substratum and 1.5–2.2 mm wide and 15–30 mm long. Rhizoids a few to nearly absent, if present, commonly appressed to the underleaves or obliquely spreading, separated. Stem cross section transversely ellipsoidal, well-developed ca 230 × 300 μm, outer cells distinctly smaller than inner, varying from 17 μm in diameter in the ventral side to 25 μm in diameter in dorsal side, with small to vestigial trigones, outer wall thin to thickened (in the ventral side), inner cells 30–40(–50) μm in diameter, with vestigial trigones and thin-walled. Leaves obliquely to very obliquely inserted, nearly plane to slightly convex and with leaf apex slightly turned to the ventral side, nearly contiguous, not decurrent dorsally and ventrally, dorsally insertion line sometimes arcuate, leaves in the slide widely ovate, 800–1100 × 600–1100 μm (small leaves are commonly longer than wider), leaf apex acute, rarely very short bifid. Underleaves distinctly decurrent for 1/2–2/3 of stem width when looking in alive material, obliquely spreading, in the slide rounded, 1.2–2.0 times wider than the stem, 260–450 × 380–700 μm, divided by U-shaped sinus into two lobes, lateral additional teeth absent or short and blunt, undivided zone 2(–4) cells high. Midleaf cells subisodiametric to oblong, 35–75 × 30–50 μm, thin-walled and trigones virtually absent; cells along leaf margin subisodiametric, 25–38 × 20–38 μm, thin-walled, trigones vestigial, but adjacent to external wall side small and concave; cuticle is smooth throughout.
Holotype: Russia, Russian Far East, Kamchatka Territory, East Kamchatka, Nalychevo Valley, middle course of Talovaya River, Kraevedcheskie Hot Springs area (53°34′30″ N 158°50′23″ E), 460 m a.s.l., flat thermal mesotrophic swamp (t~30 °C), on mineral soil, 17 August 2015, V.A. Bakalin, K-63-1-15 (VBGI).
Other specimens examined (paratypes): Russia, Russian Far East, Kamchatka Territory, East Kamchatka, Nalychevo Valley, middle course of Talovaya River, Kraevedcheskie Hot Springs area (53°34′30″ N 158°50′23″ E), 460 m a.s.l., flat thermal mesotrophic swamp (t~30 °C) in mineral soil, 17 August 2015, V.A. Bakalin, K-63-3-15 (VBGI), thermal swamp (t~15 °C) in mineral soil in hollow K-63-4-15 (VBGI), Sakhalin Province, Kuril Islands, northern part of Iturup Island, Tsirk Bay, Tsirk River middle course (45°21′45″ N 148°37′13″ E), 23 m a.s.l., moist hollow in mesotrophic swamp, 10 September 2015, V.A. Bakalin K-70-11-15, K-70-12-15 (VBGI), Kunashir Island, middle part, swampy Picea glehnii forest at middle course of Serebryanka River (44°02′57″ N 145°49′22″ E), 7 m a.s.l., partly shaded moist Sphagnum hummock, 10 September 2018, V.A. Bakalin & K.G. Klimova K-58-7-18 (VBGI), Khabarovsk Territory, Ayano-Maisky District, upper reaches of Tugorma River near the main ridge of the Dzhugdzhur Range (56°39′18.3″ N 137°15′33.9″ E), 904 m a.s.l., mosaic of Duschekia fruticosa and Pinus pumila clumps and mountain tundra vegetation on N-facing slope to stream, open wet cliff, 29 June 2019, V.A. Bakalin & K.G. Klimova Kh-38-7-19 (VBGI).
Comment. The species differs from Calypogeia neogaea in a number of features, including (1) twisting appearance when plants are dry (due to very soft texture), (2) very thin-walled leaf cells (versus slightly thickened), (3) underleaves larger (to 2 times wider than the stem, versus to 1.5 times the stem width), (4) distinctly and prominently decurrent underleaves (versus not decurrent), (5) stem cross section transversely ellipsoidal in both species, although much more planar in C. neogaea (the same as in C. fissa) and (6) leaves are variable in both taxa but are more regularly ovate in C. neogaea versus obliquely ovate-triangular in C. kamchatica. Nevertheless, the variation in the species is poorly understood. The plants from several specimens collected in Bering Island, Commander Arch (not cited here because the identity was not confirmed genetically) possess variation in the height of the undivided zone between underleaf lobes that may attain 4–5 cells.
Calypogeia fissa (L.) Raddi, Jungermanniogr. Etrusca 33, 1818.
Basionym: Mnium fissum L., Species Plantarum 1114, 1753.
Description (based on studied specimens). Plants are in loose mats, pale greenish to greenish brownish in herbarium, somewhat glistening, prostrate, loosely attached to the substratum, 1.5–3.3 mm wide and 15–30 mm long. Rhizoids a few to abundant, obliquely to erect spreading, brownish, separated or in unclear fascicles. Stem cross section transversely ellipsoidal, in well-developed plants ca. 180 × 370 μm, cell walls thin, but in the ventral side cell walls commonly thickened in two rows, outer cells the same size with inner or slightly smaller, 20–32 μm in diameter, inner cells to 38 × 48 μm, trigones very small. Leaves obliquely inserted, not decurrent in both sides, contiguous to subimbricate, nearly plane to slightly convex, sometimes with apex turned ventrally, when flattened in the slide obliquely ovate, 600–1500 × 600–1300 μm, slightly longer than wider, apex obtuse to rarely short bifid. Underleaves obliquely spreading, commonly decurrent for 1/4 of stem width when looking in alive material, in the slide transversely ellipsoidal, 220–300 × 350–650 μm, divided by U- to V-shaped sinus in to two acute lobes, additional lateral teeth common, blunt to acute, sometimes the same length with main lobe and then underleaves bisbifid. Midleaf cells are thin-walled, with small concave trigones, oblong, 50–85 × 45–63 μm; along margin 38–80 × 30–50 μm, thin-walled, with concave small trigones, trigones adjacent to external side sometimes concave.
Specimen examined: Georgia, Adjara, Mtirala National Park, upper course of Chakvistavi River, ca. 4 km upstream of Chakvistavi Village (41°40′30.1″ N 41°52′58.1″ E) 400 m a.s.l., broadleaved Colchis forest in the stream valley, cliffs in part shade, 12 May 2013, V.A. Bakalin G-12-55-13 (VBGI).
Comment. The species differs from C. neogaea in its softer plant texture (versus more or less stout), leaves planar to somewhat convex (versus slightly canaliculate), leaf apex sometimes turned ventrally (versus never turned), shortly decurrent underleaves (versus not or barely decurrent), underleaves commonly bisbifid (versus never or rarely bisbifid, although commonly with blunt lateral teeth on each side). Additionally, leaf cell walls are somewhat thickened in C. neogaea but are thin in C. fissa. It is worth mentioning that the variability in this parameter should be tested along with the variability in leaf cell size (because data suggest that leaf cells are larger in C. fissa than in C. neogaea).
Illustrations in present paper: Figure 22.
Calypogeia shevockii Bakalin et Troizk., sp. nov.
Description. Plants are whitish greenish, prostate to ascending, freely gemmiparous, loosely attached to the substratum, somewhat opaque, in loose mats, 1.2–2.5 mm wide and 10–20 μm long and merely soft. Rhizoids abundant, obliquely to erect spreading in unclear grayish fascicles. Stem cross section transversely ellipsoidal, well-developed stem ca 120 × 180 μm, outer cells with thickened walls (not so prominently to thin-walled in the ventral side), inner cells thin-walled to slightly unequally thickened, outer cells in the dorsal side the same size with inner cells, 22–30 μm in diameter, in the ventral side outer cells 20–25 μm in diameter, trigones small to vestigial throughout. Leaves obliquely inserted, dorsally insertion line somewhat arcuate, vernally leaves distinctly decurrent for 1/2–2/3 of stem width, plane to canaliculate or concave, when flattened in the slide obliquely ovate, 800–1000 × 700–1000 μm, mostly as long as wide, apex commonly acute, although in 20–25% leaves bifid, divided by shortly U-shaped sinus. Underleaves obliquely spreading, not or barely decurrent, 1.2–1.6 as wide as the stem when looking in alive material, in the slide 200–350 × 320–450 μm, mostly bisbifid or with prominent, although sometimes blunt lateral teeth, divided by widely U-shaped sinus, undivided zone 1–2 cells high, rhizogenous area of the same height, with 2–4 rows of small cells. Midleaf cells subisodiametric to shortly oblong, with slightly thickened walls, 30–50 × 30–50 μm, trigones vestigial, concave; cells along the margin with thin to thickened walls, subisodiametric to oblong, 35–50 × 35–45 μm, external wall slightly thickened, trigones adjacent to external wall moderate in size; cuticle smooth throughout. Gemmae abundant on attenuate shoot tips, 1–2-celled, commonly united into chains, spherical to ellipsoidal, with one papilla on the end, 20–25 μm in diameter of rounded and 20–38 × 18–25 μm if ellipsoidal.
Holotype: U.S.A., California, El Dorado County, Eldorado national forest (38°45′07.6″ N 120°26′00.0″ W), 4140 ft. alt., mixed conifer-hardwood forest with Cornus nuttallii, Acer marcophyllum and Aralia at hillside seeps of roadbank, 3 June 2017, J.R. Shevock 50287 (CAS, under Calypogeia fissa; duplicate in VBGI).
Comment. Morphologically, this species resembles small-sized, pale-colored Calypogeia yoshinagana (which explains the original identification of the specimen as C. fissa), which differs in its smaller, more deeply divided underleaves, commonly bifid leaf apex and pale coloration. Other morphologically similar species are Asperifolia indosinica and A. arguta, from which the species differs in its smooth leaf cuticle, outer cells in stem cross section similar to those inward (versus outer cells distinctly larger) and smaller leaf cells. In trnG topology, the species occupies a basal position to all Calypogeia s.l., except Asperifolia.
Illustrations in present paper: Figure 23.
Calypogeia pseudointegristipula Bakalin, Troizk. et Maltseva, sp. nov.
Description. Plants are green to yellowish green in fresh condition and green brownish in herbarium, prostrate, closely attached to the sunstratum, 2–3 mm wide and 10–20 mm long, more or less rigid and opaque to somewhat glistening. Rhizoids abundant, obliquely spreading, in unclear fascicles. Stem cross section transversely ellipsoidal, in well-developed sems ca 350 × 600 μm, outer cells thin-walled in the ventral side, slightly thickened in the dorsal side and distinctly thick in the inner part, trigones small, concave, outer cells 20–30 μm in diameter, inner cells 25–40 × 25–30 μm. Leaves imbricate, obliquely inserted, dorsally insertion line arcuate, ventrally not or shortly decurrent, slightly convex or nearly plane, but with apex turned to the ventral side, when flattened on the slide widely obliquely ovate, 900–1400 × 100–1800 μm, distinctly wider than longer, apex rounded to somewhat obtuse. Underleaves appressed to the stem, decurrent for 1/3–1/2 of stem width, transversely ellipsoidal, shortly emarginate to distinctly divided by semicrescentic sinus into two obtuse lobes, undivided zone 10–12 cells high, rhizogenous area well developed, 500–800 × 1000–1300 μm. Midleaf cells subisodiametric, more or less thin-walled, trigones distinct, small to moderate in size, concave, 37–60 × 33–60 μm, cuticle finely verruculose; cells along the margin with thickened external wall and other walls slightly to distinctly thickened, subisodiametric to oblong, 35–45 × 25–45 μm, trigones adjacent to external wall moderate in size, concave and cuticle loosely verruculose to nearly smooth.
Holotype: Russia, Russian Far East, Sakhalin Province, Kuril Islands, Kunashir Island, Gornaya River valley middle course (44°26′22″ N 146°12′10″ E), 220 m a.s.l., moist fallen decaying wood in part shade in the valley′s forest dominating by Picea, Abies, Sorbus commixta, Betula, 30 August 2018, V.A. Bakalin & K.G. Klimova K-34-34-18 (VBGI).
Other specimen examined (paratype): Russia, Russian Far East, Sakhalin Province, Sakhalin Island, Korsakovsky District, Bol′shoe Vavayskoe Lake south-east vicinity (46°34′38.7″ N 143°18′32.8″ E), 6–10 m a.s.l., Picea glehnii forest in the plain, mesic decaying wood in part shade, 27 September 2016, V.A. Bakalin, S-43-6-16 (VBGI).
Comment. This species is probably one of the most common taxa of the genus in the southern part of the Russian Far East (Primorsky Territory, Sakhalin Island, South Kurils) and was previously misidentified as C. integristipula. C. pseudointegristipula differs from C. integristipula in its (1) distinctly emarginate to divided underleaves and (2) distinct trigones in the leaf cells, commonly distinct thickened cell walls along the leaf margin and commonly fine verruculose cuticle. Here, we limited the list of specimens examined to those specimens used for molecular analysis, although the distribution of the taxa is likely much wider.
5. Materials and Methods
5.1. Morphology Comparison
The material used in the present study came from our own field research, herbarium specimens and type specimens stored in various herbaria (the most valuable are G, NICH, TNS, and VBGI). The vast majority of Calypogeia specimens that were collected within the last 10 years were studied under ‘fresh’ conditions for oil body parameters; in many cases, oil bodies were photographed and then described. These results have led to understandings of whether molecular genetic data correlate with the differences in oil body number, size and color. The inclusion of information on oil bodies into descriptions helps us understand if the newly revealed taxa are indeed different morphologically or are cryptic. Calypogeia, as a genus, does not have many gametophyte morphological features that could be used in a simple identification practice; moreover, many distinguishing traits are quantitative. The main attention was given to the following characteristics: (1) oil body features, where the most readily observed are color (colorless versus brownish, blue and purple) and the presence of a central ‘eye’ (C. japonica only); (2) characters of the leaf apex (rounded to acute and bidentate); (3) shape of underleaves (rounded to bifid and bisbifid); (4) shoot transparency when plants are alive (plants translucent to opaque); (5) rigidity of plants (rigid to soft); (6) leaf three-dimensional shape (planar, convex, concave, with apex turned to the ventral side or not, undulate along margin, etc.); (7) the undivided zone in the underleaf between the underleaf base (above microcellous zone providing rhizoids) and the sinus (a middle sinus of three, if underleaves are bisbifid); (8) comparative size of outer and inner cells in the stem cross section (larger that inward or nearly the same); (9) comparative size and shape of cells along the leaf margin (larger than inside, swollen, elongated along margin, with thickened cell walls); (10) midleaf cell size; (11) leaf surface feature (smooth, versus papilllose or verruculose cuticle); and (12) the presence of trigones in the midleaf (actually they are always present, but sometimes are very small) and the thickness of leaf cell walls.
All studied specimens had preliminary names prior to molecular phylogenetic studies. In addition, we had a series of specimens with apparently the same morphological parameters, and some of them were selected for molecular genetic comparison. Since the taxonomic position of specimens was sometimes altered when the molecular analysis was performed, the names were corrected. For instance, all accessions of C. kamchatica were originally named C. neogaea, and when the necessity to describe the new taxon became obvious, the names were changed.
5.2. DNA Isolation, Amplification, and Sequencing
DNA was extracted from dried liverwort tissue using the NucleoSpin Plant II Kit (Macherey-Nagel, Düren, Nordrhein-Westfalen, Germany). Amplification of chloroplast trnG-intron, chloroplast trnL–F spacer and nuclear ITS2 was performed using an Encyclo Plus PCR Kit (Evrogen, Moscow, Russia) with the primer pairs (forward and reverse) listed in Table 3. The isolated DNA was dissolved in TE buffer and stored at −20 °C. DNA concentration was measured with a Qubit fluorometer (Invitrogen, Carlsbad, CA, USA).
The polymerase chain reaction was performed in a total volume of 20 µL, including 1 µL template DNA, 0.4 µL Encyclo polymerase, 5 µL Encyclo buffer, 0.4 µL dNTP-mixture (included in Encyclo Plus PCR Kit), 13.4 µL (for trnG, trnL–F)/12.4 µL (for ITS2) double-distilled water (Evrogen, Moscow, Russia), 1 µL dimethylsulfoxide/DMSO (for ITS2) and 0.4 µL of each primer (forward and reverse, at a concentration of 5 pmol/µL). Polymerase chain reactions were carried out using the following program: 180 s initial denaturation at 95 °C, followed by 30–40 cycles of 30 s denaturation at 94 °C, 20 (trnL–F)—30 s (ITS2, trnG) annealing at 56 °C (trnG), 58 °C (trnL–F) 60 °C or 64 °C (ITS2) and 30 s elongation at 72 °C. Final elongation was carried out in one step of 5 min at 72 °C. Amplified fragments were visualized on 1% agarose TAE gels by EtBr staining and purified using the Cleanup Mini Kit (Evrogen, Moscow, Russia). The DNA was sequenced using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA) with further analysis of the reaction products following the standard protocol on the ABI Prism 3100-Avant Genetic Analyzer (Applied Biosystems, Carlsbad, CA, USA) in the Genome Center (Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow).
5.3. Phylogenetic Analyses
For the molecular phylogenetic study, three markers were used: nuclear 5.8S rRNA and ITS2 gene and plastid trnL–F region and trnG gene. Datasets were aligned by MAFFT using the E strategy [39] and then adjusted manually in BioEdit ver. 7.2.5 [40]. The absent parts of the sequences were coded as missing.
Phylogenies were reconstructed under three criteria: maximum parsimony (MP) with Mega X [41], maximum likelihood (ML) with IQ-TREE ver. 1.6.12 [42] and Bayesian Analyses (BA) with MrBayes ver. 3.2.7 [43].
MP analysis for all datasets included 1000 bootstrap replicates, default settings were used for all other parameters, and gaps were treated as partial deletions with a site coverage cut-off of 95%.
For the ML analysis with 1000 ultrafast bootstrap replicates [42], the best fitting evolutionary models chosen according to Bayesian Information Criterion (BIC) by IQ-TREE were K3Pu + F + G4 for trnG, TPM2 + F + G4 for trnL–F and TNe+ G4 for ITS2 datasets.
Bayesian analyses were performed by running two parallel analyses using the GTR + I + G model. For all datasets, the analysis consisted of four Markov chains. Chains were run for five million generations, and trees were sampled every 500th generation. The first 2500 trees in each run were discarded as burn-in; thereafter, 15,000 trees were sampled from both runs. Bayesian posterior probabilities were calculated from the trees sampled after burn-in. The average standard deviation of split frequencies between two runs was 0.0058 for trnG-intron, 0.0090 for trnL–F and 0.0076 for ITS2.
A haplotype network was constructed by the TCS network inference method [44] using the PopART package (http://popart.otago.ac.nz/) [45]. The PopART program automatically removes from the consideration positions having at least one N or a gap.
The infrageneric and infraspecific variability of the trnG intron, trnL–F and ITS2 were quantified as the average pairwise p-distances calculated in Mega X using the pairwise deletion option for counting gaps. All ambiguous positions were removed for each sequence pair.
The distribution of pairwise p-distances between sequences was tabulated by the Assemble Species by Automatic Partitioning (ASAP) program (https://bioinfo.mnhn.fr/abi/public/asap/asapweb.html, last accessed 15 February 2022) [46] with default settings and a p-distance model.
6. Conclusions
This account is only the first step to understanding Calypogeia diversity in Pacific Asia using an integrative approach; currently, many taxonomic issues remain unresolved, including the distribution of the vast majority of accepted species, which remains poorly understood. The ‘geographical races’ of each single species were not found to be genetically identical in several cases. Such supposedly circumpolar distributed taxa as C. sphagnicola, C. integristipula and C. neesiana are substituted in Amphi-Pacific Asia (at least in its temperate insular part) by related but nevertheless different taxa. Progress was made in advancing the knowledge of the taxonomic diversity of Calypogeia in Amphi-Pacific Asia due to two processes: revisiting already described but commonly neglected taxa and the description of new-to-science species.
Several particular questions remain unresolved in the course of the present study, such as the identity of the specimens named C. cuspidata from Vietnam with ‘true’ C. cuspidata described from Hawaii. Another intriguing question is the morphological differentiation of two ‘races’ of C. granulata, where specimens found in different clades may actually belong to different species based on their genetic distances.
Despite some gaps in this research, the tendency that has been noted several times in the literature is still obvious: the supposed ‘geographical races’ of the single ‘species’ from geographically remote areas may actually belong to distinct species that can be distinguished morphologically. One of the best examples is the morphological series of Calypogeia fissa s.l., where at least six species actually exist (C. tosana, C. yoshinagana, C. fissa, C. shevockii, C. kamchatica and C. neogaea).
Calypogeia in Vietnam was nearly completely neglected for a long time. This neglect is, for instance, illustrated by the fact that this genus was first recorded in Vietnam only five years ago, in 2017 by Shu et al. [26]. Currently, 10 taxa have been confirmed in the country, all of which were found in North Vietnam. Thus, the diversity of the genus in Vietnam will likely be updated in the course of further floristic studies. As shown here, three main obstacles prevent complete knowledge of the genus in this country: (1) Calypogeia are mostly hygrophilic plants and are predominantly not tropical in their distribution, which requires extensive collection in upper elevations of the mountains that may be hardly accessible; (2) oil body information is strongly required to make identifications (even if preliminary) based on morphology: this implies that the collected plants should be studied fresh as soon as possible; and (3) recent research on liverwort taxonomy has shown that semicryptic taxa and geographical vicariants are not rare cases in liverworts, and thus many difficulties arise in compiling sets for molecular genetic analyses. The listed difficulties are the same as those existing for Calypogeia in other areas of Amphi-Pacific Asia. Four species of Calypogeia are reported for Myanmar (where the taxonomic diversity in this genus may be higher than that in Vietnam), and this is the only report of the genus in that country. Thus, it is quite obvious that further study of this genus in Pacific Asia will result in the discovery of new taxa and newly revealed patterns of morphological evolution within the genus.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11070983/s1, Table S1: The value of infraspecific and infrageneric p-distances for the genus Calypogeia, Asperifolia, Mnioloma, Metacalypogeia, Geocalyx, Mesoptychia. “n/c”-non calculated value due to single DNA locus, Figure S1: In total, a 50% majority rule trees obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on trnG-intron. Scale bar denotes number of nucleotide substitutions per site, Figure S2: In total, a 50% majority rule trees obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on trnL–F. Scale bar denotes number of nucleotide substitutions per site, Figure S3: In total, a 59% majority rule trees obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on ITS 2. Scale bar denotes number of nucleotide substitutions per site.
Author Contributions
Conceptualization, V.A.B. and A.V.T.; methodology, A.V.T., V.A.B. and Y.D.M.; validation, A.V.T., V.A.B. and Y.D.M.; formal analysis, Y.D.M.; investigation, all coauthors; resources, K.G.K., Y.D.M., A.V.T., V.A.B., F.M., V.S.N. and S.S.C.; data curation, A.V.T., V.S.N. and S.S.C.; writing—original draft preparation, V.A.B. and Y.D.M.; writing—review and editing, Y.D.M., K.G.K., F.M. and V.S.N.; visualization, K.G.K. and Y.D.M. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Russian Foundation for Basic Research, grant number 20-54-54002; Russian Academy of Sciences: grant number 1021043000529-9; Vietnam Academy of Science and Technology: grant number ĐT.05-22; Korean National Institute of Ecology: grant number NIE-A-2022-01.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Acknowledgments
Authors thank curators of G, NICH, TNS for the kind permission to work in those herbaria. Line-art figures were kindly prepared by Matvei Bakalin to whom authors are sincerely grateful. Authors are grateful for the support to the Russian Foundation for Basic Research (grant 20-54-54002 for V.A.B., Y.D.M. & K.G.K.), Botanical Garden-Institute research project “Cryptogamic Biota of Pacific Asia” (no. 1021043000529-9 for V.A.B., Y.D.M. & K.G.K.), the project from the Institute of Ecology and Biological Resources (no. ĐT.05-22 for V.S.N., V.A.B. & K.G.K.). The work of SSC was partially supported by a grant from the National Ecosystem Survey of the National Institute of Ecology (NIE-A-2022-01).
Conflicts of Interest
The authors declare no conflict of interest.
References
- Bakalin, V.A.; Klimova, K.G.; Nguyen, V.S. A review of Calypogeia (Marchantiophyta) in the eastern Sino-Himalaya and Meta-Himalaya based mostly on types. PhytoKeys 2020, 153, 111–154. Available online: https://phytokeys.pensoft.net/article/52920/ (accessed on 15 February 2022). [CrossRef] [PubMed]
- Bakalin, V.; Vilnet, A.; Klimova, K.; Nguyen, V.S. Calypogeia vietnamica sp. nov. (Calypogeiaceae, Hepaticae) from North Vietnam and diversification in Calypogeia taxa with blue oil bodies. Herzogia 2019, 32, 219–229. [Google Scholar] [CrossRef]
- Buczkowska, K. Genetic differentiation of Calypogeia fissa Raddi (Hepaticae, Jungermanniales) in Poland. Plant. Syst. Evol. 2004, 247, 187–201. [Google Scholar] [CrossRef]
- Buczkowska, K. The genus Calypogeia Raddi (Jungermanniales, Hepaticae) in Poland, biometrical analysis of morphological and anatomical variation. Nova Hedwig. 2004, 78, 121–146. [Google Scholar] [CrossRef]
- Buczkowska, K.; Bączkiewicz, A. New taxon of the genus Calypogeia (Jungermanniales, Hepaticae) in Poland. Acta Soc. Bot. Pol. 2011, 80, 327–333. [Google Scholar] [CrossRef] [Green Version]
- Buczkowska, K.; Gonera, P.; Bączkiewicz, A.; Rosadziński, S.; Rabska, M. Chloroplast DNA sequences confirmed genetic divergence within Calypogeia muelleriana (Calypogeiaceae, Marchantiophyta). Biodivers. Res. Conserv. 2015, 32, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Buczkowska, K.; Bakalin, V.; Bączkiewicz, A.; Aguero, B.; Gonera, P.; Ślipiko, M.; Szczecińska, M.; Sawicki, J. Does Calypogeia azurea (Calypogeiaceae, Marchantiophyta) occur outside Europe? Molecular and morphological evidence. PLoS ONE 2018, 13, e0204561. [Google Scholar] [CrossRef]
- Warnstorf, C. Die europäischen Artengruppen der Gattung Calypogeia Raddi (1820). Bryol. Z. 1917, 1, 97–114. [Google Scholar]
- Schuster, R.M. The Hepaticae and Anthocerotae of North America. II; Columbia University Press: New York, NY, USA, 1969; 1062p. [Google Scholar]
- Müller, K. Die Lebermoose Europas. In Dr. L. Rabenhorst’s Kryptogamen-Flora von Deutschland, Österreich und der Schweiz, 3rd ed.; Akademische Verlagsgesellschaft: Leipzig, Germany, 1956; Volume 6, pp. 917–1076. [Google Scholar]
- Inoue, H. Miscellaneous notes on hepatics of Japan (3). Jpn. J. Bot. 1962, 37, 101–105. [Google Scholar]
- Inoue, H. Notes on the Calypogeia neesiana complex in Japan. Mem. Natl. Sci. Mus. 1971, 4, 55–58. [Google Scholar]
- Konstantinova, N.A.; Bakalin, V.A.; Andrejeva, E.N.; Bezgodov, A.G.; Borovichev, E.A.; Dulin, M.V.; Mamontov, Y.S. Checklist of liverworts (Marchantiophyta) of Russia. Arctoa 2009, 18, 1–64. [Google Scholar] [CrossRef]
- Bakalin, V.A. Liverworts of Kamchatka: The results of study. In Proceedings of the VII International Scientific Conference “Conservation of Biodiversity of Kamchatka and Coastal Waters”, Petropavlovsk-Kamchatsky, Russia, 28–29 November 2007; pp. 6–14. [Google Scholar]
- Bakalin, V.A. Distribution of Bryophytes in the Russian Far East. Part. I; Hepatics; Izd-vo DVFU: Vladivostok, Russia, 2010; 175p. [Google Scholar]
- Stotler, R.E.; Crandall-Stotler, B. A Synopsis of the Liverwort Flora of North America North of Mexico. Ann. Mo. Bot. Gard. 2017, 102, 574–709. [Google Scholar] [CrossRef]
- Söderström, L.; Váňa, J.; Hagborg, A.; von Konrat, M. Notes on Early Land Plants Today. 35. Notes on Lophoziaceae (Marchantiophyta). Phytotaxa 2013, 97, 27–35. [Google Scholar] [CrossRef] [Green Version]
- Hattori, S. Hepaticae and Anthocerotae of Mt. Chokai, Northern Japan. J. Hattori Bot. Lab. 1966, 29, 267–278. [Google Scholar]
- Choi, S.S.; Bakalin, V.; Park, S.J. Integrating continental mainland and islands in temperate East Asia: Liverworts and hornworts of the Korean Peninsula. PhytoKeys 2021, 176, 131–226. [Google Scholar] [CrossRef] [PubMed]
- Stephani, F. Species hepaticarum 3. Bull. L’herbier Boissier (Sér. 2) 1908, 8, 661–696. [Google Scholar] [CrossRef]
- Bonner, C.E.B. Index Hepaticarum; J. Cramer: Weinheim, Germany, 1963; pp. 3–4, 1–926. [Google Scholar]
- Grolle, R. Verzeichnis der Lebermoose Europas und benachbarter Gebiete. Feddes Repert. 1976, 87, 171–279. [Google Scholar] [CrossRef]
- Meuche, D.; Huneck, S. Azulene aus Calypogeia trichomanis (L.) Corda. Chem. Ber. 1966, 99, 2669–2674. [Google Scholar] [CrossRef]
- Bakalin, V.; Nguyen, V.S.; Klimova, K.; Bakalin, D.; Nguyen, H.M. Where and how many new additions to the liverwort flora of Vietnam may be found? Bryologist 2021, 124, 391–402. [Google Scholar] [CrossRef]
- Bakalin, V.A.; Nguyen, V.S.; Borovichev, E.A. New liverwort records for Vietnam. J. Bryol. 2018, 40, 68–73. [Google Scholar] [CrossRef]
- Shu, L.; Xiang, Y.-L.; Cheng, X.-F.; Wei, Y.-M.; Wang, J.; Zhang, L.-N.; Li, W.; Yin, X.-B.; Zhang, W.-P.; Zhao, C.-X.; et al. New Liverwort and Hornwort Records for Vietnam. Cryptogam. Bryol. 2017, 38, 411–445. [Google Scholar] [CrossRef]
- Stephani, F. Hepaticae sandvicenses. Bull. L’herbier Boissier 1897, 5, 840–849. [Google Scholar]
- Yang, J.D.; Lin, S.H. Calypogeia aeruginosa Mitten, a newly recorded liverwort to Taiwan. Endem. Species Res. 2009, 11, 93–99. [Google Scholar]
- Inoue, H. A new species of Calypogeia Raddi. Jpn. J. Bot. 1968, 43, 468–472. [Google Scholar]
- Furuki, T.; Ota, M. Taxonomical study of Calypogeia japonica (Hepaticae) described from Japan. Bryol. Res. 2001, 7, 381–384. [Google Scholar]
- Yao, K.Y.; Yang, J.D. Calypogeia japonica Stephani, a Newly Recorded Liverwort in Taiwan. Guójiā Gōngyuán Xuébào Èr (Natl. Park J.) 2015, 25, 76–80. [Google Scholar]
- Inoue, H. Illustrations of Japanese Hepaticae; Tsukiji Shokan Publishing Company: Tsukuba, Japan, 1974; 189p. [Google Scholar]
- Milyutina, I.A.; Goryunov, D.V.; Ignatov, M.S.; Ignatova, E.A.; Troitsky, A.V. The phylogeny of Schistidium (Bryophyta, Grimmiaceae) based on the primary and secondary structure of nuclear rDNA internal transcribed spacers. Mol. Biol. 2010, 44, 883–897. [Google Scholar] [CrossRef]
- Groth, H.; Helms, G.; Heinrichs, J. The systematic status of Plagiochila sects. Bidentes Carl and Caducilobae Inoue (Hepaticae) inferred from nrDNA ITS sequences. Taxon 2003, 51, 675–684. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Snisky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef]
- Taberlet, P.; Gielly, L.; Guy Pautou, G.; Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 1991, 17, 1105–1109. [Google Scholar] [CrossRef] [PubMed]
- Bakalin, V.; Maltseva, Y.; Vilnet, A.; Choi, S.S. The transfer of Tritomaria koreana to Lophozia has led to recircumscription of the genus and shown convergence in Lophoziaceae (Hepaticae). Phytotaxa 2021, 512, 41–56. [Google Scholar] [CrossRef]
- Pacak, A.; Szweykowska-Kulinska, Z. Molecular data concerning alloploid character and the origin of chloroplast and mitochondrial genomes in the liverwort species Pellia borealis. J. Plant Biotechnol. 2000, 2, 101–108. [Google Scholar]
- Katoh, K.; Standley, D.N. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Ronquist, F.; Teslenko, M.; van Der Mark, P.; Ayres, D.L.; Darling, S.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clement, M.; Snell, Q.; Walker, P.; Posada, D.; Crandall, K. TCS: Estimating gene genealogies. In Proceedings of the 16th International Parallel and Distributed Processing Symposium, Fort Lauderdale, FL, USA, 15–19 April 2002; p. 184. [Google Scholar] [CrossRef]
- Leigh, J.W.; Bryant, D. Popart: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Puillandre, N.; Brouillet, S.; Achaz, G. ASAP: Assemble species by automatic partitioning. Mol. Ecol. Resour. 2021, 21, 609–620. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Phylogram obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on trnG-intron. Bootstrap support values > 50% in the MP and ML analyses and Bayesian posterior probabilities > 50% are indicated. Calypogeia species possessing blue oil bodies are marked with an asterisk (*). Scale bar denotes number of nucleotide substitutions per site.
Figure 1.
Phylogram obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on trnG-intron. Bootstrap support values > 50% in the MP and ML analyses and Bayesian posterior probabilities > 50% are indicated. Calypogeia species possessing blue oil bodies are marked with an asterisk (*). Scale bar denotes number of nucleotide substitutions per site.
Figure 2.
TCS haplotype network of trnG sequences.
Figure 3.
Results of Assemble Species by Automatic Partitioning (ASAP) analysis for trnG-intron sequences. Distribution of pairwise differences. Dt.—distance value; Nbr—number of runs.
Figure 3.
Results of Assemble Species by Automatic Partitioning (ASAP) analysis for trnG-intron sequences. Distribution of pairwise differences. Dt.—distance value; Nbr—number of runs.
Figure 4.
Phylogram obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on trnL–F. Bootstrap support values > 50% in MP and ML analyses and Bayesian posterior probabilities > 0.50 are indicated. Scale bar denotes number of nucleotide substitutions per site.
Figure 4.
Phylogram obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on trnL–F. Bootstrap support values > 50% in MP and ML analyses and Bayesian posterior probabilities > 0.50 are indicated. Scale bar denotes number of nucleotide substitutions per site.
Figure 5.
Phylogram obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on ITS2. Bootstrap support values > 50% in MP and ML analyses and Bayesian posterior probabilities > 0.50 are indicated. Scale bar denotes number of nucleotide substitutions per site.
Figure 5.
Phylogram obtained in a Bayesian analysis for the genus Calypogeia and related taxa based on ITS2. Bootstrap support values > 50% in MP and ML analyses and Bayesian posterior probabilities > 0.50 are indicated. Scale bar denotes number of nucleotide substitutions per site.
Figure 6.
Calypogeia aeruginosa Mitt.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–J) Underleaves; (K) Midleaf cells. All from V-8-36-17 (VBGI).
Figure 6.
Calypogeia aeruginosa Mitt.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–J) Underleaves; (K) Midleaf cells. All from V-8-36-17 (VBGI).
Figure 7.
Calypogeia apiculata (Steph.) Steph.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–K) Underleaves; (L) Midleaf cells. All from V-10-28-17 (VBGI).
Figure 7.
Calypogeia apiculata (Steph.) Steph.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–K) Underleaves; (L) Midleaf cells. All from V-10-28-17 (VBGI).
Figure 8.
Calypogeia cuspidata (Steph.) Steph.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–H) Leaves; (I–O) Underleaves. All from C-44-1-17 (VBGI).
Figure 8.
Calypogeia cuspidata (Steph.) Steph.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–H) Leaves; (I–O) Underleaves. All from C-44-1-17 (VBGI).
Figure 9.
Calypogeia granulata Inoue: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–K) Underleaves. All from V-8-67-17 (VBGI).
Figure 9.
Calypogeia granulata Inoue: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–K) Underleaves. All from V-8-67-17 (VBGI).
Figure 10.
Calypogeia sinensis Bakalin & Buczk.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–K) Underleaves. All from V-5-24-17 (VBGI).
Figure 10.
Calypogeia sinensis Bakalin & Buczk.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–K) Underleaves. All from V-5-24-17 (VBGI).
Figure 11.
Calypogeia tosana (Steph.) Steph.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–J) Underleaves. All from V-3-73-17 (VBGI).
Figure 11.
Calypogeia tosana (Steph.) Steph.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–F) Leaves; (G–J) Underleaves. All from V-3-73-17 (VBGI).
Figure 12.
Asperifolia indosinica Bakalin et Troizk., sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–H) Leaves; (I–P) Underleaves; (Q) Stem cross section. All from V-1-112-16 (VBGI).
Figure 12.
Asperifolia indosinica Bakalin et Troizk., sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–H) Leaves; (I–P) Underleaves; (Q) Stem cross section. All from V-1-112-16 (VBGI).
Figure 13.
Asperifolia indosinica Bakalin et Troizk., sp. nov.: (A,C,E) Midleaf cells with oil bodies; (B,D) Parts of mats; (F) Shoot; (G) Leaf margin cells with oil bodies; (H) Underleaf; (I) Leaf apex cells with oil bodies. Scales: 100 µm for (A,C,E,G,I); 500 µm for (H); 1 mm for (B,D,F). (A,B) from V-3-14-17; (C,F) from V-2-22-16; (D) from V-7-58-18; (E,G–I) from V-19-9-19. All from VBGI.
Figure 13.
Asperifolia indosinica Bakalin et Troizk., sp. nov.: (A,C,E) Midleaf cells with oil bodies; (B,D) Parts of mats; (F) Shoot; (G) Leaf margin cells with oil bodies; (H) Underleaf; (I) Leaf apex cells with oil bodies. Scales: 100 µm for (A,C,E,G,I); 500 µm for (H); 1 mm for (B,D,F). (A,B) from V-3-14-17; (C,F) from V-2-22-16; (D) from V-7-58-18; (E,G–I) from V-19-9-19. All from VBGI.
Figure 14.
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–I) Leaves; (K–S) Underleaves; (J) Stem cross section. All from V-21-17-18 (VBGI).
Figure 14.
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–I) Leaves; (K–S) Underleaves; (J) Stem cross section. All from V-21-17-18 (VBGI).
Figure 15.
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C,E,F) Underleaves; (D) Archegonia; (G) Leaf margin cells; (H) Midleaf cells; (J) Stem cross section. Scales: 1 mm for (A,B); 200 µm for (C–F); 100 µm for (G–I). All from 13-081-094-G (DR, VBGI).
Figure 15.
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C,E,F) Underleaves; (D) Archegonia; (G) Leaf margin cells; (H) Midleaf cells; (J) Stem cross section. Scales: 1 mm for (A,B); 200 µm for (C–F); 100 µm for (G–I). All from 13-081-094-G (DR, VBGI).
Figure 16.
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., sp. nov.: (A,B) Plant habit, fragment, ventral view; (C,D) Leaves; (E) Part of mat; (F) Leaf margin cells; (H) Leaf apex cells. Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva, sp. nov.: (G) Mat. Scales: 1 mm for (A,B); 500 µm for (C,D); 100 µm for (F,H); 5 mm for (E,G). (A–F,H) from V-21-18-18; (G) from Kh-40-36-13. All from VBGI.
Figure 16.
Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk., sp. nov.: (A,B) Plant habit, fragment, ventral view; (C,D) Leaves; (E) Part of mat; (F) Leaf margin cells; (H) Leaf apex cells. Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva, sp. nov.: (G) Mat. Scales: 1 mm for (A,B); 500 µm for (C,D); 100 µm for (F,H); 5 mm for (E,G). (A–F,H) from V-21-18-18; (G) from Kh-40-36-13. All from VBGI.
Figure 17.
Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva, sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–I) Leaves; (J–Q) Underleaves; (R) Stem cross-section. All from Kh-40-28-13 (VBGI).
Figure 17.
Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva, sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–I) Leaves; (J–Q) Underleaves; (R) Stem cross-section. All from Kh-40-28-13 (VBGI).
Figure 18.
Calypogeia neogaea (R.M. Schust.) Bakalin: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–J) Leaves; (K–Q) Underleaves; (R) Stem cross section. All from US-41a-77-14 (VBGI).
Figure 18.
Calypogeia neogaea (R.M. Schust.) Bakalin: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–J) Leaves; (K–Q) Underleaves; (R) Stem cross section. All from US-41a-77-14 (VBGI).
Figure 19.
Calypogeia kamchatica Bakalin, Troizk. et Maltseva, sp. nov.: (A) Plant habit, fragment, dorsal view; (B–D) Plant habit, fragment, ventral view; (E–K) Leaves; (L–S) Underleaves; (T) Stem cross section. (C) From K-129-21-04 and (A–T) from K-63-1-15. All from VBGI.
Figure 19.
Calypogeia kamchatica Bakalin, Troizk. et Maltseva, sp. nov.: (A) Plant habit, fragment, dorsal view; (B–D) Plant habit, fragment, ventral view; (E–K) Leaves; (L–S) Underleaves; (T) Stem cross section. (C) From K-129-21-04 and (A–T) from K-63-1-15. All from VBGI.
Figure 20.
Calypogeia kamchatica Bakalin, Troizk. et Maltseva, sp. nov.: (A) Plant habit, fragment, dorsal view; (B,C,E) Plant habit, fragment, ventral view; (D,F,H) Underleaves; (G) Mat. Scales: 2 mm for (A,B,E); 1 mm for (C); 5 mm for (G); 500 µm for (D,F,H). (A–C) From K-70-11-15; (D) From K-63-3-15; (E,G) From K-70-12-15; (F,H) From K-58-7-18. All from VBGI.
Figure 20.
Calypogeia kamchatica Bakalin, Troizk. et Maltseva, sp. nov.: (A) Plant habit, fragment, dorsal view; (B,C,E) Plant habit, fragment, ventral view; (D,F,H) Underleaves; (G) Mat. Scales: 2 mm for (A,B,E); 1 mm for (C); 5 mm for (G); 500 µm for (D,F,H). (A–C) From K-70-11-15; (D) From K-63-3-15; (E,G) From K-70-12-15; (F,H) From K-58-7-18. All from VBGI.
Figure 21.
Calypogeia kamchatica Bakalin, Troizk. et Maltseva, sp. nov.: (A) Underleaf; (B) Underleaf lobe cells with oil bodies; (C,F) Midleaf cells with oil bodies; (D) Cells in underleaf sinus; (E) Leaf apex cells with oil bodies. Scales: 500 µm for (A); 100 µm for (B,C,E,F). (A,D) From K-58-7-18; (B,E,F) From Kh-38-7-19; (C) From K-63-4-15. All from VBGI.
Figure 21.
Calypogeia kamchatica Bakalin, Troizk. et Maltseva, sp. nov.: (A) Underleaf; (B) Underleaf lobe cells with oil bodies; (C,F) Midleaf cells with oil bodies; (D) Cells in underleaf sinus; (E) Leaf apex cells with oil bodies. Scales: 500 µm for (A); 100 µm for (B,C,E,F). (A,D) From K-58-7-18; (B,E,F) From Kh-38-7-19; (C) From K-63-4-15. All from VBGI.
Figure 22.
Calypogeia fissa (L.) Raddi: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–I) Leaves; (J–R) Underleaves; (S) Stem cross section. All from G-12-55-13 (VBGI).
Figure 22.
Calypogeia fissa (L.) Raddi: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–I) Leaves; (J–R) Underleaves; (S) Stem cross section. All from G-12-55-13 (VBGI).
Figure 23.
Calypogeia shevockii Bakalin et Troizk., sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–I) Leaves; (J–S) Underleaves; (T) Gemmae; (U) Stem cross section. All from Shevock 50287 (CAS, under Calypogeia fissa; duplicate in VBGI).
Figure 23.
Calypogeia shevockii Bakalin et Troizk., sp. nov.: (A) Plant habit, fragment, dorsal view; (B) Plant habit, fragment, ventral view; (C–I) Leaves; (J–S) Underleaves; (T) Gemmae; (U) Stem cross section. All from Shevock 50287 (CAS, under Calypogeia fissa; duplicate in VBGI).
Figure 24.
Calypogeia pseudointegristipula Bakalin, Troizk. et Maltseva, sp. nov.: (A) Plant habit, fragment, dorsal view; (B,C) Plant habit, fragment, ventral view; (D) Stem cross section, fragment; (E–K) Leaves; (L–S) Underleaves. All from K-34-34-18 (VBGI).
Figure 24.
Calypogeia pseudointegristipula Bakalin, Troizk. et Maltseva, sp. nov.: (A) Plant habit, fragment, dorsal view; (B,C) Plant habit, fragment, ventral view; (D) Stem cross section, fragment; (E–K) Leaves; (L–S) Underleaves. All from K-34-34-18 (VBGI).
Figure 25.
Calypogeia pseudointegristipula Bakalin, Troizk. et Maltseva, sp. nov.: (A) Underleaf; (B) Plant habit, fragment, ventral view; (C) Gemma with oil bodies; (D,F) Mats; (E) Verruculose cuticle; (G,H) Midleaf cells with oil bodies; (I) Leaf margin cells with oil bodies. Scales: 500 µm for (A); 2 mm for (B,D); 5 mm for (F); 100 µm for (C,E,G–I). (A,B,D,E,G,I) From K-34-34-18; (C,F,H) From S-43-3-16. All from VBGI.
Figure 25.
Calypogeia pseudointegristipula Bakalin, Troizk. et Maltseva, sp. nov.: (A) Underleaf; (B) Plant habit, fragment, ventral view; (C) Gemma with oil bodies; (D,F) Mats; (E) Verruculose cuticle; (G,H) Midleaf cells with oil bodies; (I) Leaf margin cells with oil bodies. Scales: 500 µm for (A); 2 mm for (B,D); 5 mm for (F); 100 µm for (C,E,G–I). (A,B,D,E,G,I) From K-34-34-18; (C,F,H) From S-43-3-16. All from VBGI.
Table 1.
The list of taxa, specimen vouchers and GenBank accession numbers.
| Initial Species Name | Accepted Name | Label | GenBank Accession Number | ||
|---|---|---|---|---|---|
| ITS | trnL | trnG | |||
| Calypogeia aeruginosa Mitt. | Calypogeia aeruginosa Mitt. | Vietnam, Lao Cai Province, V.A. Bakalin & K.G. Klimova, V-8-36-17 (VBGI) | - | OL408961 | - |
| Calypogeia angusta Steph. | Calypogeia suecica (Arnell et J.Perss.) Müll. Frib. | Japan, Honshu Island, V.A. Bakalin, J-88-54-15 (VBGI) | OL689055 | OL408989 | OL311475 |
| Calypogeia apiculata (Steph.) Steph. | Calypogeia apiculata (Steph.) Steph. | Vietnam, Lao Cai Province, V.A. Bakalin & K.G. Klimova, V-2-7-17 (VBGI) | - | - | OL311465 |
| Calypogeia apiculata (Steph.) Steph. | Calypogeia apiculata (Steph.) Steph. | Vietnam, Lao Cai Province, V.A. Bakalin & K.G. Klimova, V-3-81-17 (VBGI) | - | - | OL311466 |
| Calypogeia apiculata (Steph.) Steph. | Calypogeia apiculata (Steph.) Steph. | Vietnam, Lao Cai Province, V.A. Bakalin & K.G. Klimova, V-10-28-17 (VBGI) | OL689064 | OL409000 | OL311463 |
| Calypogeia arguta Nees et Mont. | Asperifolia arguta (Nees et Mont.) Troizk., Bakalin, Maltseva | Germany, A. Solga & D. Quandt, POZW 39075 | MH367567 | MH367811 | MH367685 |
| Calypogeia arguta Nees et Mont. | Asperifolia arguta (Nees et Mont.) Troizk., Bakalin, Maltseva | Spain, Galicia, A. Schäfer-Verwimp, S-V 31365 | MH367568 | MH367812 | * MH367686 |
| Calypogeia arguta Nees et Mont. | Asperifolia indosinica Troizk. et Bakalin | Vietnam, Lai Châu Province, V.A. Bakalin & K.G. Klimova, V-16-3-19 (VBGI) | OL689056 | OL408990 | OL311426 |
| Calypogeia arguta Nees et Mont. | Asperifolia indosinica Troizk. et Bakalin | Vietnam, Sơn La Province, V.A. Bakalin & K.G. Klimova, V-19-9-19 (VBGI) | OL689065 | OL409001 | OL311427 |
| Calypogeia arguta Nees et Mont. | Asperifolia arguta (Nees et Mont.) Troizk., Bakalin, Maltseva | Georgia, Adjaria, V.A. Bakalin, G-11-44-13 (VBGI) | OL689057 | OL409010 | OL311472 |
| Calypogeia arguta Nees et Mont. | Asperifolia indosinica Troizk. et Bakalin | Vietnam, Lao Cai Province, V.A. Bakalin, V-1-112-16 (VBGI) | OL689079 | OL409012 | OL311470 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | S Poland, K. Buczkowska & A. Baczkiewicz, POZW 41776 | MH367534 | MH367768 | MH367646 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | Germany, A. Schäfer-Verwimp, S-V 31563 | MH367544 | MH367778 | MH367656 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | Germany, A. Schäfer-Verwimp, S-V 30124 | MH367545 | MH367779 | * MH367657 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | North America, Canada, British Columbia, B. Aguero, POZW 42447 | MH367548 | MH367782 | MH367660 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | Russia, Buryatiya Republic, N. Konstantinova & A. Savchenko, 20-01 (KPABG) | JX629936 | * JX630063 | - |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | NE Poland, K. Buczkowska & A. Bączkiewicz, POZW 41778 | MH367532 | * MH367766 | * MH367644 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | S Poland, A. Bączkiewicz & K. Buczkowska, POZW 41390 | MH367533 | * MH367767 | * MH367645 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | S Poland, K. Buczkowska & A. Bączkiewicz, POZW 41371 | MH367535 | * MH367769 | * MH367647 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | S Poland, K. Buczkowska & A. Bączkiewicz, POZW 41378 | MH367536 | * MH367770 | * MH367648 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | SE Poland, K. Buczkowska & B. Chmielewska, POZW 41925 | MH367537 | * MH367771 | * MH367649 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | SE Poland, K. Buczkowska & B. Chmielewska, POZW 41929 | MH367538 | * MH367772 | * MH367650 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | SE Poland, K. Buczkowska & B. Chmielewska, POZW 41948 | MH367539 | * MH367773 | * MH367651 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | SE Poland, K. Buczkowska & B. Chmielewska, POZW 42390 | MH367540 | * MH367774 | * MH367652 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | SE Poland, K. Buczkowska & B. Chmielewska, POZW 42373 | MH367541 | * MH367775 | * MH367653 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | SE Poland, K. Buczkowska & B. Chmielewska, POZW 42360 | MH367542 | * MH367776 | * MH367654 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | Austria, A. Schäfer-Verwimp, S-V 27519/A | MH367543 | * MH367777 | * MH367655 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | Romania, S. Ştefănut, POZW 42609 | MH367546 | * MH367780 | * MH367658 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | Russia, Northern Caucasus, Karachai-Cherkessk Republic, N.A. Konstantinova & A.N. Savchenko, HRE 57 | MH367547 | * MH367781 | * MH367659 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | North America, Vancouver Island, B. Aguero, POZW 42444 | MH367549 | MH367783 | MH367661 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | USA, California Modoc Plateau, W.T. Doyle, MO 6005455 | MH367550 | * MH367784 | * MH367662 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | USA, Washington, W. Hong, MO 5241997 | MH367551 | * MH367785 | * MH367663 |
| Calypogeia azurea Stotler et Crotz | Calypogeia azurea Stotler et Crotz | USA, California, W.T. Doyle, 00234919 (NYBG) | MH367552 | * MH367786 | * MH367664 |
| Calypogeia cf. apiculata (Steph.) Steph. | Calypogeia cf. apiculata (Steph.) Steph. | Vietnam, Lao Cai Province, V.A. Bakalin, V-1-104-16 (VBGI) | OL689072 | - | - |
| Calypogeia cf. fissa (L.) Raddi | Calypogeia fissa (L.) Raddi | Georgia, Adjaria, V.A. Bakalin, G-12-70-13 (VBGI) | OL689083 | - | OL311474 |
| Calypogeia cf. integristipula Steph. | Calypogeia pseudointegristipula Bakalin, Troizk. et Maltseva | Russia, Sakhalin Province, Southern Kuril Islands, Kunashir Island, V.A. Bakalin & K.G. Klimova, K-34-34-18 (VBGI) | OL689071 | OL409006 | OL311448 |
| Calypogeia cf. japonica Steph. | Calypogeia sp. | Russia, Russian Far East, Southern Kurils, Kunashir Island, V.A. Bakalin & K.G. Klimova, K-35-22-18 (VBGI) | OL689074 | OL409008 | - |
| Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Poland, K. Buczkowska & A. Bączkiewicz, POZW 42211 | KR909089 | * KF371566 | * KF371618 |
| Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Poland, K. Buczkowska & A. Bączkiewicz, POZW 42220 | KR909087 | * KF371568 | * KF371620 |
| Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Poland, K. Buczkowska & A. Bączkiewicz, POZW 41707 | KR909086 | * KF371570 | * KF371622 |
| Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Poland, K. Buczkowska & A. Bączkiewicz, POZW 41706 | KR909085 | * KF371571 | * KF371623 |
| Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Poland, K. Buczkowska & A. Bączkiewicz, POZW 42285a | KR909088 | * KF371573 | * KF371625 |
| Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | Calypogeia cf. muelleriana (Schiffn.) Müll.Frib. | USA, B.K. Andreas, B.K.Andreas dhl825 | KR909090 | * KF371575 | * KF371627 |
| Calypogeia cf. sphagnicola f. paludosa (Warnst.) R.M. Schust. | Calypogeia cf. sphagnicola f. paludosa (Warnst.) R.M. Schust. | S Poland, POZW 41166 | - | * JQ658799 | JQ658782 |
| Calypogeia cf. tosana (Steph.) Steph. | Calypogeia japonica Steph. | Vietnam, Lao Cai Province, V.A. Bakalin & K.G. Klimova, V-1-31-17 (VBGI) | OL689036 | OL409013 | OL311467 |
| Calypogeia cuspidata (Steph.) Steph. | Calypogeia cuspidata (Steph.) Steph. | China, Sichuan Province, V.A. Bakalin & K.G. Klimova, C-44-1-17 (VBGI) | OL689041 | OL408967 | OL311478 |
| Calypogeia cuspidata (Steph.) Steph. | Calypogeia cuspidata (Steph.) Steph. | China, Sichuan Province, V.A. Bakalin & K.G. Klimova, C-40-6-17 (VBGI) | OL689038 | OL409015 | OL311480 |
| Calypogeia fissa (L.) Raddi | Calypogeia fissa (L.) Raddi | Germany, A. Solga, D. Quandt, POZW 39074 | - | MH367827 | * MH367701 |
| Calypogeia fissa (L.) Raddi | Calypogeia fissa (L.) Raddi | W Poland, Lubuskie Province, S. Rosadzinski, POZW 42437 | - | MH367828 | * MH367702 |
| Calypogeia fissa (L.) Raddi | Calypogeia fissa (L.) Raddi | Germany, A. Schäfer-Verwimp, S-V 25448 | - | MH367829 | MH367703 |
| Calypogeia fissa (L.) Raddi | Calypogeia fissa (L.) Raddi | North America, Canada, Nova Scotia, J. Macoun, POZW 3337 | - | MH367831 | MH367705 |
| Calypogeia fissa (L.) Raddi | Calypogeia aff. fissa (L.) Raddi | Ireland, J.S. Thomson, POZW 3344 | - | MH367832 | MH367706 |
| Calypogeia fissa (L.) Raddi | Calypogeia aff. fissa (L.) Raddi | Spain, C. Casas, POZW 3345 | - | MH367833 | MH367707 |
| Calypogeia fissa (L.) Raddi | Calypogeia fissa (L.) Raddi | Hungary, L. Vajda, POZW 3347 | - | MH367834 | MH367708 |
| Calypogeia fissa (L.) Raddi | Calypogeia aff. fissa (L.) Raddi | Iceland, Austurnssysla, V.V. Buryy, Ice-3-3-17 | - | OL408960 | OL311418 |
| Calypogeia fissa (L.) Raddi | Calypogeia shevockii Bakalin et Troizk. | USA, California State, J.R. Shevock, 50287 | OL689039 | OL408965 | OL311477 |
| Calypogeia fissa (L.) Raddi | Calypogeia fissa (L.) Raddi | Georgia, Adjaria, V.A. Bakalin, G-12-55-13 (VBGI) | OL689037 | OL408968 | OL311473 |
| Calypogeia fissa (L.) Raddi | Asperifolia sullivantii (Austin) Troizk., Bakalin, Maltseva | USA, Sainte Genevieve County, V.A. Bakalin, US-41a-80-14 (VBGI) | OL689045 | OL408971 | OL409018 |
| Calypogeia fissa (L.) Raddi subsp. fissa | Calypogeia fissa (L.) Raddi subsp. fissa | Poland, S. Rosadziński, POZW 42628 | KR909073 | * KR909061 | - |
| Calypogeia fissa (L.) Raddi subsp. fissa | Calypogeia fissa (L.) Raddi subsp. fissa | Poland, K. Buczkowska & J. Szweykowski, POZW 39203 | KR909074 | * KR909062 | - |
| Calypogeia fissa (L.) Raddi subsp. fissa | Calypogeia fissa (L.) Raddi subsp. fissa | Poland, K. Buczkowska, POZW 42225 | KR909075 | * KR909063 | - |
| Calypogeia fissa (L.) Raddi subsp. fissa | Calypogeia fissa (L.) Raddi subsp. fissa | Poland, K. Buczkowska, POZW 42227 | KR909076 | * KR909064 | - |
| Calypogeia fissa (L.) Raddi subsp. fissa | Calypogeia fissa (L.) Raddi subsp. fissa | Poland, K. Buczkowska & A. Bączkiewicz, POZW 42345 | KR909077 | * KR909065 | - |
| Calypogeia fissa (L.) Raddi subsp. fissa | Calypogeia fissa (L.) Raddi subsp. fissa | Poland, K. Buczkowska & A. Bączkiewicz, POZW 42205 | KR909078 | * KR909066 | - |
| Calypogeia fissa (L.) Raddi subsp. fissa | Calypogeia fissa (L.) Raddi subsp. fissa | Poland, K. Buczkowska & A. Bączkiewicz, POZW 42200 | KR909079 | * KR909067 | - |
| Calypogeia fissa (L.) Raddi subsp. fissa | Calypogeia fissa (L.) Raddi subsp. fissa | Poland, S. Rosadziński & K. Buczkowska, POZW 42298 | KR909080 | * KR909068 | - |
| Calypogeia fissa subsp. neogaea R.M. Schust. | Calypogeia neogaea (R.M. Schust.) Bakalin | USA, North Carolina, B. Shaw, POZW 42620 | KR909081 | KR909069 | - |
| Calypogeia fissa subsp. neogaea R.M. Schust. | Calypogeia neogaea (R.M. Schust.) Ba-kalin | USA, North Carolina, B. Shaw, POZW 42622 | KR909082 | KR909070 | - |
| Calypogeia fissa subsp. neogaea R.M. Schust. | Calypogeia neogaea (R.M. Schust.) Bakalin | USA, North Carolina, B. Shaw, POZW 42625 | KR909083 | KR909071 | - |
| Calypogeia fissa subsp. neogaea R.M. Schust. | Calypogeia neogaea (R.M. Schust.) Bakalin | USA, North Carolina, B. Shaw, POZW 42626 | KR909084 | KR909072 | - |
| Calypogeia granulata Inoue | Calypogeia granulata Inoue | Vietnam, Lai Châu Province, V.A. Bakalin & K.G. Klimova, V-13-8-19 (VBGI) | OL689076 | - | OL311419 |
| Calypogeia granulata Inoue | Calypogeia granulata Inoue | Vietnam, Sơn La Province, V.A. Bakalin & K.G. Klimova, V-21-16-19 (VBGI) | OL689080 | - | OL311420 |
| Calypogeia granulata Inoue | Calypogeia granulata Inoue | Vietnam, Lai Châu Province, V.A. Bakalin & K.G. Klimova, V-3-4-19 (VBGI) | OL689084 | - | OL311421 |
| Calypogeia granulata Inoue | Calypogeia granulata Inoue | Vietnam, Lai Châu Province, V.A. Bakalin & K.G. Klimova, V-8-4-19 (VBGI) | OL689034 | - | OL311422 |
| Calypogeia granulata Inoue | Calypogeia granulata Inoue | Japan, H. Inoue, JE 18004 | MH367564 | MH367802 | MH367680 |
| Calypogeia granulata Inoue | Calypogeia granulata Inoue | China, Guizhou Province, V.A. Bakalin, China-56-19-13 (VBGI) | MH367566 | MH367804 | * MH367682 |
| Calypogeia granulata Inoue | Calypogeia granulata Inoue | Vietnam, Hà Giang Province, V.A. Bakalin & K.G. Klimova, V-11-24-20 (VBGI) | OL689050 | OL770363 | OL770364 |
| Calypogeia granulata Inoue | Calypogeia granulata Inoue | Japan, Kuroyama, H. Inoue, 2792205 (NYGB) | MH367565 | * MH367803 | * MH367681 |
| Calypogeia integristipula Steph. | Calypogeia integristipula Steph. | Finland, He-Nygrèn & Piippo 1472 | - | AY463550 | - |
| Calypogeia integristipula Steph. | Calypogeia integristipula Steph. | NE Poland, K. Buczkowska & A. Bączkiewicz, POZW 41730 | - | MH367823 | * MH367697 |
| Calypogeia integristipula Steph. | Calypogeia integristipula Steph. | SE Poland, K. Buczkowska & B. Chmielewski, POZW 41928 | - | MH367824 | * MH367698 |
| Calypogeia integristipula Steph. | Calypogeia integristipula Steph. | NE Poland, K. Buczkowska & A. Bączkiewicz, POZW 41785 | - | MH367825 | * MH367699 |
| Calypogeia integristipula Steph. | Calypogeia integristipula Steph. | NW Poland, K. Buczkowska & A. Bączkiewicz, POZW 41188 | - | MH367826 | MH367700 |
| Calypogeia integristipula Steph. | Calypogeia integristipula Steph. | Russia, Russian Far East, Khabarovsk Territory, V.A. Bakalin, Kh-28-7-16 (VBGI) | OL689044 | OL408970 | OL311423 |
| Calypogeia japonica Steph. | Calypogeia japonica Steph. | Japan, Honshu Island, V.A. Bakalin, J-1-15-13 (VBGI) | - | OL408974 | OL311424 |
| Calypogeia japonica Steph. | Calypogeia japonica Steph. | Japan, Shikoku Island, V.A. Bakalin, J-4-3-15 (VBGI) | OL689047 | OL408975 | OL311476 |
| Calypogeia japonica Steph. | Calypogeia japonica Steph. | Japan, Kyushu Island, V.A. Bakalin, J-7-30-14 (VBGI) | OL689048 | OL408976 | OL311425 |
| Calypogeia japonica Steph. | Calypogeia sp. | Vietnam, Lao Cai Province, V.A. Bakalin, V-4-22-16 (VBGI) | OL689053 | OL408981 | - |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia muelleriana (Schiffn.) Müll.Frib. | Russia, Perm Province, N. Konstantinova, K 367-1-04 (KPABG) | JX629935 | * JX630062 | - |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia muelleriana (Schiffn.) Müll.Frib. | Poland, K. Buczkowska & A. Bączkiewicz, POZW 41346 | - | KF371550 | * KF371602 |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia muelleriana (Schiffn.) Müll.Frib. | Poland, K. Buczkowska, A. Baczkiewicz, POZW 41182 | - | * KF371551 | KF371603 |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia muelleriana (Schiffn.) Müll.Frib. | Netherlands, J. Szweykowski, R. Gradstein, H. Greven, POZW 34160 | - | KF371563 | * KF371615 |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia muelleriana (Schiffn.) Müll.Frib. | Russia, Russian Far East, Kamchatka Territory, V.A. Bakalin, K-50-2-15 (VBGI) | - | OL408982 | - |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva | Russia, Russian Far East, Khabarovsk Territory, V.A. Bakalin, Kh-23-2-16 (VBGI) | OL689054 | OL408983 | OL311453 |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia muelleriana (Schiffn.) Müll.Frib. | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-31-26-12 (VBGI) | - | OL408984 | - |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-32-41a-12 (VBGI) | - | OL408985 | OL311455 |
| Calypogeia muelleriana (Schiffn.) Müll.Frib. | Calypogeia pseudointegristipula Bakalin, Troizk. et Maltseva | Russia, Russian Far East, Sakhalin Province, Sakhalin Island, V.A. Bakalin, S-43-6-16 (VBGI) | - | OL408986 | OL311457 |
| Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Poland, POZW 41952 | - | MK294001 | - |
| Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Poland, K. Buczkowska, A. Baczkiewicz, POZW 41735 | - | MH367820 | * MH367694 |
| Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Poland, K. Buczkowska, B. Chmielewski, POZW 41927 | - | MH367821 | * MH367695 |
| Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Poland, K. Buczkowska, A. Baczkiewicz, POZW 41358 | - | MH367822 | * MH367696 |
| Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Poland, POZW 41731 | - | MK294002 | - |
| Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Poland, K. Buczkowska, A. Baczkiewicz, POZW 41731 | - | MH367819 | MH367693 |
| Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Russia, Russian Far East, Sakhalin Province, Sakhalin Island, S.V. Dudov, 2016_Br_0073 | - | OL408987 | OL311434 |
| Calypogeia neesiana (C.Massal. et Carestia) Müll.Frib. | Calypogeia muelleriana (Schiffn.) Müll. Frib. | Russia, Russian Far East, Sakhalin Province, Sakhalin Island, S.V. Dudov & K.V. Kotelnikova, 2014_Br_0205 | - | OL408988 | OL409017 |
| Calypogeia neesiana ssp. subalpina (Inoue) Inoue | Calypogeia subalpina Inoue | Japan, Honshu Island, V.A. Bakalin, J-87-1-15 (VBGI) | - | OL408993 | OL311450 |
| Calypogeia neogaea (R.M. Schust.) Bakalin | Calypogeia kamchatica Bakalin, Troizk. et Maltseva | Russia, Russian Far East, Kamchatka Territory, V.A. Bakalin, HRE, 28 (VBGI) | OL689060 | OL408994 | OL311445 |
| Calypogeia neogaea (R.M. Schust.) Bakalin | Calypogeia kamchatica Bakalin, Troizk. et Maltseva | Russia, Russian Far East, Kamchatka Territory, V.A. Bakalin, K-63-1-15 (VBGI) | OL689061 | OL408995 | OL311446 |
| Calypogeia neogaea (R.M. Schust.) Bakalin | Calypogeia tosana (Steph.) Steph. | Russia, Russian Far East, Sakhalin Province, Iturup Island, V.A. Bakalin, K-72-13-15 (VBGI) | OL689062 | OL408996 | OL311452 |
| Calypogeia neogaea (R.M. Schust.) Bakalin | Calypogeia neogaea (R.M. Schust.) Bakalin | USA, Sainte Genevieve County, V.A. Bakalin, US-41-77-14 (VBGI) | OL689063 | OL408997 | OL311428 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Russia, Russian Far East, Primorsky Territory, V.A. Bakalin, P-40-1-12 (VBGI) | - | * MH367790 | MH367668 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Japan, M. Higuchi, 02532867 (NYBG) | - | * MH367795 | MH367673 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Japan, K. Yamada, Yamada 8912 | - | * MH367796 | MH367674 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Russia, Russian Far East, Primorsky Territory, V.A. Bakalin, P-15-12-12 (VBGI) | MH367553 | MH367788 | MH367666 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Russia, Russian Far East, Primorsy Territory, V.A. Bakalin, P-39-4-12 (VBGI) | MH367554 | MH367789 | MH367667 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Korea, Gangwon Province, V.A. Bakalin, Kor-7-23-11 (VBGI) | MH367555 | * MH367791 | * MH367669 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Korea, Gangwon Province, V.A. Bakalin, Kor-10-02-11 (VBGI) | MH367556 | * MH367792 | MH367670 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Korea, Gangwon Province, V.A. Bakalin, Kor-7-36-11 (VBGI) | MH367557 | * MH367793 | MH367671 |
| Calypogeia orientalis Buczkowska et Bakalin | Calypogeia orientalis Buczkowska et Bakalin | Japan, Kyushu Island, V.A. Bakalin, J-7-79-14 (VBGI) | MH367558 | * MH367794 | MH367672 |
| Calypogeia peruviana Nees et Mont. | Calypogeia peruviana Nees et Mont. | USA, North Carolina, B. Aguero, POZW 42619 | MH367562 | MH367800 | MH367678 |
| Calypogeia peruviana Nees et Mont. | Calypogeia peruviana Nees et Mont. | USA, North Carolina, B. Aguero, POZW 42627 | MH367563 | MH367801 | * MH367679 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | Vietnam, Sơn La Province, V.A. Bakalin & K.G. Klimova, V-21-26-19 (VBGI) | - | - | OL311429 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | Vietnam, Sơn La Province, V.A. Bakalin & K.G. Klimova, V-23-15-19 (VBGI) | - | - | OL311430 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | China, Guizhou Proivince, V.A. Bakalin, China-56-77-13 (VBGI) | MH367559 | MH367797 | MH367675 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | China, Guizhou Proivince, V.A. Bakalin, China-56-78-13 (VBGI) | MH367560 | * MH367798 | MH367676 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | Vietnam, Lao Cai Province, V.A. Bakalin, V-2-73-16 (VBGI) | MH367561 | * MH367799 | MH367677 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | Vietnam, Hà Giang Province, V.A. Bakalin & K.G. Klimova, V-11-7-20 (VBGI) | OL689032 | OL408962 | OL311462 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | Vietnam, Cao Bằng Province, V.A. Bakalin & K.G. Klimova, V-27-4-20 (VBGI) | OL689035 | OL408964 | OL311469 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | Vietnam, Cao Bằng Province, V.A. Bakalin & K.G. Klimova, V-24-10-20 (VBGI) | OL689078 | OL409011 | OL311468 |
| Calypogeia sinensis Bakalin et Buczkowska | Calypogeia sinensis Bakalin et Buczkowska | Vietnam, Hà Giang Province, V.A. Bakalin & K.G. Klimova, V-11-23-20 (VBGI) | OL689082 | OL409014 | OL311461 |
| Calypogeia sp. nov. | Calypogeia granulata Inoue | Vietnam, Lao Cai Province, V.A. Bakalin, V-1-130-16 (VBGI) | OL689042 | - | OL311447 |
| Calypogeia sp. | Calypogeia apiculata (Steph.) Steph. | Vietnam, Lai Châu Province, V.A. Bakalin & K.G. Klimova, V-12-5-19 (VBGI) | OL689043 | OL408969 | OL311464 |
| Calypogeia sp. | Calypogeia pseudocuspidata Bakalin, Frank Müll. et Troizk. | Vietnam, Lao Cai Province, V.A. Bakalin & K.G. Klimova, V-21-17-18 (VBGI) | OL689046 | OL408972 | OL311458 |
| Calypogeia sp. | Calypogeia sp. | Russia, Russian Far East, Primorsky Territory, V.A. Bakalin, P-37-20-14 | - | OL408973 | - |
| Calypogeia sp. | Calypogeia muelleriana (Schiffn.) Müll.Frib. | Russia, Russian Far East, Khabarovsk Territory, K.G. Klimova, Khab-69-31-18 (VBGI) | OL689049 | OL408977 | - |
| Calypogeia sp. | Calypogeia apiculata (Steph.) Steph. | Vietnam, Lai Châu Province, V.A. Bakalin & K.G. Klimova, V-4-15-19 (VBGI) | OL689051 | OL408979 | OL311459 |
| Calypogeia sp. | Calypogeia sp. | Japan, Honshu Island, M. Higuchi, BSE, 1293 | OL689059 | OL408992 | - |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva | Russia, Russian Far East, Khabarovsk Territory, V.A. Bakalin, Kh-40-28-13 (VBGI) | - | - | OL311454 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Russia, Russian Far East, Khabarovsk Territory, K.G. Klimova, Khab-68-14-18 (VBGI) | - | - | OL311432 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-38-16-12 (VBGI) | - | - | OL311433 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Calypogeia sp. | Japan, H. Inoue, KRAM 50656 | - | - | MH367709 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Russia, Russian Far East, Kamchatka Territory, V.A. Bakalin, K-54-1-15 (VBGI) | - | OL408998 | OL311431 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske | Calypogeia pseudosphagnicola Bakalin, Troizk. et Maltseva | Russia, Russian Far East, Sakhalin Province, Sakhalin Island, V.A. Bakalin, S-17-3-17 (VBGI) | - | OL408999 | OL311456 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | NW Poland, K. Buczkowska & A. Bączkiewicz, POZW 42284 | - | JQ658790 | JQ658773 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | NW Poland, K. Buczkowska & A. Bączkiewicz, POZW 42245 | - | JQ658791 | * JQ658774 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | Poland, K. Buczkowska & A. Bączkiewicz, POZW 42351 | - | JQ658792 | * JQ658775 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | NW Poland, K. Buczkowska & A. Bączkiewicz, POZW 42266 | - | JQ658793 | * JQ658776 |
| Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | Calypogeia sphagnicola (Arnell et J.Perss.) Warnst. et Loeske f. sphagnicola | NE Poland, K. Buczkowska & A. Bączkiewicz, POZW 41711 | - | JQ658794 | JQ658777 |
| Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | S Poland, K. Buczkowska & A. Bączkiewicz, POZW 41174 | - | JQ658795 | JQ658778 |
| Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | S Poland, K. Buczkowska & A. Bączkiewicz, POZW 41148 | - | JQ658796 | JQ658779 |
| Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | S Poland, K. Buczkowska & A. Bączkiewicz, POZW 42277 | - | JQ658797 | * JQ658780 |
| Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | Calypogeia sphagnicola f. paludosa (Warnst.) Schust. | S Poland, K. Buczkowska & A. Bączkiewicz, POZW 41722 | - | JQ658798 | * JQ658781 |
| Calypogeia suecica (Arnell et J.Perss.) Müll. Frib. | Calypogeia suecica (Arnell et J.Perss.) Müll. Frib. | Poland, J. Szweykowski, K. Buczkowska, POZW 39500 | - | * MH367815 | MH367689 |
| Calypogeia suecica (Arnell et J.Perss.) Müll. Frib. | Calypogeia suecica (Arnell et J.Perss.) Müll. Frib. | Russia, Russian Far East, Khabarovsk Territory, K.G. Klimova, Khab-60-34-18 (VBGI) | - | - | OL311436 |
| Calypogeia suecica (Arnell et J.Perss.) Müll. Frib. | Calypogeia sp. | Russia, Russian Far East, Primorsky Territory, V.A. Bakalin & G. Arutinov, P-2-6a-13 (VBGI) | - | - | OL311460 |
| Calypogeia suecica (Arnell et J.Perss.) Müll. Frib. | Calypogeia suecica (Arnell et J.Perss.) Müll. Frib. | Russia, Russian Far East, Primorsky Territory, V.A. Bakalin, P-37-1-14 (VBGI) | - | - | OL311437 |
| Calypogeia sullivantii Austin | Asperifolia sullivantii (Austin) Troizk., Bakalin, Maltseva | USA, North Carolina, B. Aguero, POZW 42623 | MH367569 | MH367813 | MH367687 |
| Calypogeia sullivantii Austin | Asperifolia sullivantii (Austin) Troizk., Bakalin, Maltseva | USA, Maryland, L.T. Biechele, NYGB 2169286 | MH367570 | MH367814 | * MH367688 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | China, Guizhou Province, V.A. Bakalin, C-55-72-13 (VBGI) | OL689067 | - | OL311438 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | China, Guizhou Proivince, V.A. Bakalin, China-56-86-13 (VBGI) | - | MH367807 | * MH367683 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | Japan, Kyushu Island, Fukuoka Prefecture, V.A. Bakalin, J-4-38-14 (VBGI) | - | MH367808 | MH367684 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | Vietnam, Lao Cai Province, V.A. Bakalin, V-1-102-16 (VBGI) | OL689033 | OL408963 | - |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | Vietnam, Cao Bằng Province, V.A. Bakalin & K.G. Klimova, V-23-2-20 (VBGI) | OL689040 | OL408966 | OL311471 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | China, Guizhou Province, V. A. Bakalin, C-55-19-13 (VBGI) | - | OL408978 | OL311479 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | Vietnam, Lai Châu Province, V.A. Bakalin & K.G. Klimova, V-16-2-19 (VBGI) | OL689052 | OL408980 | OL311440 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | Republic of Korea, Jeollabuk-do, V.A. Bakalin & S.S. Choi, Kor-73-16-19 (VBGI) | OL689058 | OL408991 | OL311435 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | Republic of Korea, Jeollabuk-do, V.A. Bakalin & S.S. Choi, Kor-79-25-19 (VBGI) | OL689066 | OL409002 | OL311439 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia yoshinagana Steph. | Japan, Kyushu Island, V.A. Bakalin, J-40-52-14 (VBGI) | OL689068 | OL409003 | OL311449 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | Russia, Russian Far East, Sakhalin Province, Iturup Island, V.A. Bakalin, K-70-35-15 (VBGI) | OL689069 | OL409004 | OL311451 |
| Calypogeia tosana (Steph.) Steph. | Calypogeia yoshinagana Steph. | Republic Of Korea, Jeju Island, V.A. Bakalin, Kor-29-64-15 (VBGI) | OL689070 | OL409005 | - |
| Calypogeia tosana (Steph.) Steph. | Calypogeia tosana (Steph.) Steph. | Japan, Honshu Island, V.A. Bakalin, J-5-9-13 (VBGI) | - | OL409009 | - |
| Calypogeia vietnamica Bakalin et Vilnet | Calypogeia vietnamica Bakalin et Vilnet | Vietnam, Lao Cai Province, V.A. Bakalin & K.G. Klimova, V-8-61-17 (VBGI) | MK335824 | MK336253 | - |
| Calypogeia vietnamica Bakalin et Vilnet | Calypogeia vietnamica Bakalin et Vilnet | Vietnam, Lao Cai Province, V.A. Bakalin & K.G. Klimova, V-9-23-17 (VBGI) | MK335825 | MK336254 | - |
| Calypogeia yoshinagana Steph. | Calypogeia yoshinagana Steph. | Republic of Korea, Jeollabuk-do, V.A. Bakalin & S.S. Choi, Kor-72-5-19 (VBGI) | OL689075 | - | OL311442 |
| Calypogeia yoshinagana Steph. | Calypogeia yoshinagana Steph. | Republic of Korea, Jeollabuk-do, V.A. Bakalin & S.S. Choi, Kor-79-22-19 (VBGI) | OL689077 | - | OL311443 |
| Calypogeia yoshinagana Steph. | Calypogeia yoshinagana Steph. | Republic of Korea, Jeollabuk-do, V.A. Bakalin & S.S. Choi, Kor-82-3-19 (VBGI) | OL689081 | - | OL311444 |
| Calypogeia yoshinagana Steph. | Calypogeia yoshinagana Steph. | Republic of Korea, Gyeongsangnam-do, V.A. Bakalin & S.S. Choi, Kor-70-1-19 (VBGI) | OL689073 | OL409007 | OL311441 |
| Geocalyx graveolens (Schrad.) Nees | Geocalyx graveolens (Schrad.) Nees | China, Yunnan Province, D.G. Long, 34828 (E) | - | * KJ802067 | KJ802038 |
| Mesoptychia sahlbergii (Lindb. et Arnell) A. Evans | Mesoptychia sahlbergii (Lindb. et Arnell) A. Evans | USA, D.G. Long, 11329 (E) | KJ206417 | - | - |
| Mesoptychia gillmanii (Austin) L. Söderstr. et Váňa | Mesoptychia gillmanii (Austin) L. Söderstr. et Váňa | Sweden, A. Cailliau & N. Lonnell, 982 (G) | KJ206404 | * KJ206363 | - |
| Mesoptychia gillmanii (Austin) L. Söderstr. et Váňa | Mesoptychia gillmanii (Austin) L. Söderstr. et Váňa | Russia, N.A. Konstantinova & A.N. Savchenko, 117-1-00 (F) | - | * KJ802075 | KJ802047 |
| Mesoptychia heterocolpos (Thed. ex Hartm.) L. Söderstr. et Váňa | Mesoptychia heterocolpos (Thed. ex Hartm.) L. Söderstr. et Váňa | USA, Alaska, B. Shaw, F965a/3 (DUKE) | - | * KF943057 | KF942896 |
| Mesoptychia heterocolpos (Thed. ex Hartm.) L. Söderstr. et Váňa | Mesoptychia heterocolpos (Thed. ex Hartm.) L. Söderstr. et Váňa | Sweden, A. Cailliau, 999 (G) | KJ206411 | * KJ206371 | - |
| Mesoptychia heterocolpos (Thed. ex Hartm.) L. Söderstr. et Váňa | Mesoptychia heterocolpos (Thed. ex Hartm.) L. Söderstr. et Váňa | Russia, Komi Rep., Dulin M.V., 116749 (KPABG) | - | * KM501496 | KM501477 |
| Mesoptychia heterocolpos var. harpanthoides (Bryhn et Kaal.) L. Söderstr. et Váňa | Mesoptychia heterocolpos var. harpanthoides (Bryhn et Kaal.) L. Söderstr. et Váňa | Russia, Arkhangelsk Prov., Franz Josef Land, Ziegler Island, A. Savchenko, CA-19-29-8c (KPABG) | - | * MT431408 | MT431398 |
| Mesoptychia sahlbergii (Lindb. et Arnell) A. Evans | Mesoptychia sahlbergii (Lindb. et Arnell) A. Evans | Russia, V. Fedosov, 107967 (F) | - | * KJ802078 | KJ802050 |
| Metacalypogeia alternifolia (Nees) Grolle | Metacalypogeia alternifolia (Nees) Grolle | Bhutan, D.G. Long, 28712 (E) | - | KJ802068 | KJ802040 |
| Metacalypogeia cordifolia (Steph.) Inoue | Metacalypogeia cordifolia (Steph.) Inoue | Russia, Russian Far East, Primorsky Territory, V.A. Bakalin, P-66-18a-06 (VBGI) | * JX629934 | JF421597 | - |
| Mnioloma fuscum (Lehm.) R.M. Schust. | Mnioloma fuscum (Lehm.) R.M. Schust. | South Africa, de Roo, s.n. (BOL) | - | - | AM397718 |
| Mnioloma fuscum (Lehm.) R.M. Schust. | Mnioloma fuscum (Lehm.) R.M. Schust. | Fiji, J.E. Braggins et al. 16 Apr 2008 (NSW) | - | KJ802100 | - |
* GenBank numbers marked with an asterisk are not included in the phylogenetic trees, because of their supposed heterogeneity.
Table 2.
Intergeneric p-distances over sequence pairs between groups. The number of base differences per site from averaging over all sequence pairs between groups is shown.
Table 2.
Intergeneric p-distances over sequence pairs between groups. The number of base differences per site from averaging over all sequence pairs between groups is shown.
| Taxon | Intergeneric p-Distances, trnG-Intron/trnL−F/ITS2 | ||||
|---|---|---|---|---|---|
| Calypogeia | Asperifolia | Mnioloma | Metacalypogeia | Geocalyx | |
| Asperifolia | 0.17/0.13/0.13 | ||||
| Mnioloma | 0.17/0.16/- | 0.17/0.16/- | |||
| Metacalypogeia | 0.15/0.12/- | 0.21/0.15/- | 0.20/0.16/- | ||
| Geocalyx | 0.15/0.17/- | 0.2/0.18/- | 0.19/0.18/- | 0.18/0.14/- | |
| Mesoptychia | 0.16/0.15/0.19 | 0.19/0.17/0.22 | 0.18/0.19/- | 0.19/0.13/- | 0.16/0.13/- |
Table 3.
Primers used in the polymerase chain reaction (PCR) and cycle sequencing reactions.
| Locus | Sequence (5′-3′) | Direction | Annealing Temperature (°C) | Reference |
|---|---|---|---|---|
| ITS2 nrDNA | GCATCGATGAAGAACGCAGC | forward | 62 | [33] |
| ITS2 nrDNA | GATATGCTTAAACTCAGCGG | reverse | 58 | [33] |
| ITS2 nrDNA | GAGTCATCAGCTCGCGTTGAC | forward | 66 | [34] |
| ITS2 nrDNA | GCTGCGTTCTTCATCGATGC | reverse | 62 | [35] |
| trnL–F cpDNA | CGAATTCGGTAGACGCTACG | forward | 62 | [36] |
| trnL–F cpDNA | ATTTGAACTGGTGACACGAG | reverse | 58 | [36] |
| trnL–F cpDNA | CGAAATTGGTAGACGCTGCG | forward | 62 | [37] |
| trnL–F cpDNA | TGCCAGAAACCAGATTTGAAC | reverse | 60 | [37] |
| trnG-intron cpDNA | ACCCGCATCGTTAGCTTG | forward | 56 | [38] |
| trnG-intron cpDNA | GCGGGTATAGTTTAGTGG | reverse | 54 | [38] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Bakalin, V.A.; Maltseva, Y.D.; Müller, F.; Klimova, K.G.; Nguyen, V.S.; Choi, S.S.; Troitsky, A.V. Calypogeia (Calypogeiaceae, Marchantiophyta) in Pacific Asia: Updates from Molecular Revision with Particular Attention to the Genus in North Indochina. Plants 2022, 11, 983. https://doi.org/10.3390/plants11070983
AMA Style
Bakalin VA, Maltseva YD, Müller F, Klimova KG, Nguyen VS, Choi SS, Troitsky AV. Calypogeia (Calypogeiaceae, Marchantiophyta) in Pacific Asia: Updates from Molecular Revision with Particular Attention to the Genus in North Indochina. Plants. 2022; 11(7):983. https://doi.org/10.3390/plants11070983
Chicago/Turabian StyleBakalin, Vadim A., Yulia D. Maltseva, Frank Müller, Ksenia G. Klimova, Van Sinh Nguyen, Seung Se Choi, and Aleksey V. Troitsky. 2022. "Calypogeia (Calypogeiaceae, Marchantiophyta) in Pacific Asia: Updates from Molecular Revision with Particular Attention to the Genus in North Indochina" Plants 11, no. 7: 983. https://doi.org/10.3390/plants11070983
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
