Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 Molecular phylogenetics and taxonomy of Hypocenomyce sensu lato (Ascomycota: Lecanoromycetes): Extreme polyphyly and morphological/ecological convergence Mika Bendiksby & Einar Timdal Natural History Museum, University of Oslo, P.O. Box 1172 Blindern, 0318 Oslo, Norway Author for correspondence: Einar Timdal, einar.timdal@nhm.uio.no Abstract We have addressed phylogenetic relationships and tested hypotheses about five presumed subgroups among 15 species of Hypocenomyce s.l. (including Pycnora) by use of nuclear (ITS, LSU) and mitochondrial (SSU) ribosomal DNA-regions. Bayesian, likelihood and parsimony phylogenetic analyses, of a dataset with broad Lecanoromycete taxon sampling, mostly support the five presumed subgroups, but two of these were found to be polyphyletic (the H. friesii-group and Pycnora). The seven supported Hypocenomyce s.l. clades belong in different genera, families, orders and even subclasses, and represent a remarkable example of morphological and ecological convergence. Based on our molecular phylogenetic results, we split Hypocenomyce into four genera placed in two subclasses: (1) Carbonicola gen. nov. (Carbonicolaceae fam. nov., Lecanorales, Lecanoromycetidae; including C. anthracophila comb. nov., C. foveata comb. nov., and C. myrmecina comb. nov.); (2) Fulgidea gen. nov. (Umbilicariaceae, Umbilicariales, Umbilicariomycetidae subcl. nov.; including F. oligospora comb. nov. and F. sierrae comb. nov.); (3) Hypocenomyce (Ophioparmaceae, Umbilicariales; including H. australis, H. scalaris, and H. tinderryensis; and (4) Xylopsora gen. nov. (Umbilicariaceae; including X. caradocensis comb. nov. and X. friesii comb. nov.). We split Pycnora into two genera: (1) Pycnora (Pycnoraceae fam. nov., Candelariales, “Candelariomycetidae”; including P. praestabilis, P. sorophora, and P. xanthococca); and (2) Toensbergia gen. nov. (Sporastatiaceae fam. nov., unknown order, Lecanoromycetidae; including T. leucococca comb. nov.). We place Hypocenomyce isidiosa in Xylographa (Trapeliaceae, Baeomycetales, Ostropomycetidae; X. isidiosa comb. nov.). We place the family Ophioparmaceae in the Umbilicariales. Our type studies have shown that the epithet “myrmecina” should replace “castaneocinerea”, and lectotypes are chosen for Lecidea friesii Ach., L. scalaris var. myrmecina Ach., Psora cladonioides var. albocervina Räsänen, and P. cladonioides var. castaneocinerea Räsänen. Elixia cretica is reported as new to North America (from Mexico) and Australia. Keywords burnt wood; Hypocenomyce; lecideoid lichens; molecular phylogenetics; polyphyly; taxonomy Supplementary Material The Electronic Supplement (Figs. S1 and S2) and the alignment files are available in the Supplementary Data section of the online version of this article (http://www.ingentaconnect.com/content/iapt/tax). Received: 20 Sep. 2012; revision received: 23 Apr. 2013; accepted: 28 Aug. 2013. DOI: http://dx.doi.org/10.12705/625.18 INTRODUCTION The lichen genus Hypocenomyce M. Choisy grows on bark and wood, especially on burnt trunks and stumps in conifer forests (Fig. 1). Hypocenomyce sensu lato (s.l.; including Pycnora Hafellner) is widely distributed in the Northern Hemisphere and also occurs in Australia. Seventeen species have been assigned to Hypocenomyce, of which two have been shown to belong elsewhere (reviewed below). Timdal (1984a) revised the genus and identified four evolutionary groups. More recently described Hypocenomyce species have been assigned to one of these groups or to a fifth group. The characters uniting the five groups are mainly morphological and ecological, and Timdal (1984a: 93) hypothesized that the genus was polyphyletic. Table 1 shows the main anatomical and chemical differences between the five species groups based on the data of Timdal (1984a, 2001, 2002) and Elix (2009). Although the Hypocenomyce xanthococca-group (Table 1), which does not grow on burnt wood, was raised to the level of genus (as Pycnora) by 940 Hafellner in Hafellner & Türk (2001), all four species assigned to that group are included in the present study together with the eleven remaining Hypocenomyce species. Two Hypocenomyce (H. friesii (Ach.) P. James & Gotth. Schneid. and H. scalaris (Ach.) M. Choisy) and two Pycnora (P. sorophora (Vain.) Hafellner and P. xanthococca (Sommerf.) Hafellner) species were included in a molecular phylogenetic study of the Lecanoromycetes by Wedin & al. (2005). Their phylogenetic results corroborated a polyphyletic Hypocenomyce s.l.: (1) Hypocenomyce friesii was strongly supported as sister to Umbilicaria Hoffm.; (2) H. scalaris (two accessions) was sister to a clade consisting of Boreoplaca Timdal and Ophioparma Norman; and, (3) a clade of P. sorophora and P. xanthococca was either sister to the Acarosporaceae (parsimony) or the Candelariaceae (Bayesian). The H. scalaris– Boreoplaca–Ophioparma group was corroborated in a separate study of Lecanoromycetes phylogeny (Miądlikowska & al., 2006), in which two different collections of H. scalaris were included. Version of Record (identical to print version). TAXON 62 (5) • October 2013: 940–956 Bendiksby & Timdal • Polyphyletic Hypocenomyce Fig. 1. A, typical habitat, burnt stump in boreal pine forest, Norway; B, Carbonicola anthracophila, Norway (O L-179442); C, C. foveata, Australia (O L-50, holotype); D, C. myrmecina, Norway (O L-179443); E, Fulgidea oligospora, U.S.A. (O L-767, holotype); F, F. sierrae, U.S.A. (O L-60059, holotype); G, Hypocenomyce australis, Australia, Elix 6153 (CANB); H, H. scalaris, Sweden (O L-170870); I, Pycnora praestabilis, Sweden (O L-144278); J, P. sorophora, Sweden (O L-144312); K, P. xanthococca, Norway (O L-149736); L, Toensbergia leucococca, Norway (O L-170828); M, Xylographa isidiosa, Australia (CANB 737037-1, isotype); N, Xylopsora caradocensis, Norway (O L-73317); O, X. friesii, Norway (O L-158541). ― Photos: E. Timdal. Version of Record (identical to print version). 941 Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 Table 1. Morphological and chemical differences between the five Hypocenomyce species groups. Black dot means presence of the character, black dot in brackets means that the character is rarely present, and questions mark means unknown. Species group Additional species anthracophila friesii oligospora scalaris xanthococca castaneocinerea foveata caradocensis isidiosa sierrae australis tinderryensis leucococca praestabilis sorophora ● ● ● ● ● ● Apothecia ● brown, convex black, plane Proper exciple entirely conglutinated; hyphae thick-walled, with thread-like lumina; inner part colorless; rim pale brown; not containing crystals ● entirely conglutinated, hyphae thin-walled, with ellipsoid lumina; inner part and rim blackish brown; not containing crystals only partly conglutinated, hyphae thin-walled, with ellipsoid lumina; inner part colorless; rim green; containing crystals (lecanoric acid) ● ● Epihymenium brown, N− ● ● ● ● green, N+ violet ● without amorphous substances ● ● with amorphous substances, effusion in K brown ● ● ● with amorphous substances, effusion in K violet Paraphyses ● capitate, with an apical brown pigment cap ● not capitate, without pigment cap ● ● ● Ascus ● clavate, without cap; tholus with amyloid tube ● clavate, without cap; tholus with lateral amyloid zone rhombic, with apical cap; tholus small, deeply amyloid ● immature ● ? (●) ● Pycnidum wall brown, N− ● ● ● ● green, N+ violet ● Pycnoconinida filiform ● ● (●) bacilliform ● ● ● ellipsoid (●) ● ● subglobose Main secondary compound ● alectorialic acid colensoic acid friesiic and/or confriesiic acid ● ● ● lecanoric acid ● thamnolic acid 942 ● Version of Record (identical to print version). Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 Taxonomic history. — Hypocenomyce was introduced by Choisy (1951) for the single species H. scalaris which had been placed in Lecidea Ach. sect. Psora (Hoffm.) Schaer. by Zahlbruckner (1925, as Lecidea ostreata (Hoffm.) Schaer.) The genus was originally characterized by having a squamulose thallus, lecideine, adnate apothecia and short, straight, cylindrical pycnoconidia. Choisy (1953) later also included H. rubiformis (Ach.) M. Choisy in the genus; a species which is now regarded as belonging in Psora Hoffm. (as P. rubiformis (Ach.) Hook., cf. Timdal, 1984b; Ekman & Blaalid, 2011) and is not discussed further in this paper. Schneider (1980) proposed a new generic arrangement for the species placed in Lecidea sect. Psora sensu Zahlbruckner. He accepted Hypocenomyce and added two more squamulose species to it, H. anthracophila (Nyl.) P. James & Gotth. Schneid. and H. friesii. Three more species were soon added, one transferred from Toninia A. Massal. (H. caradocensis (Nyl.) P. James & Gotth. Schneid. in Hawksworth & al., 1980) and two crustose species from Lecidea sect. Lecidea sensu Zahlbruckner (H. xanthococca (Sommerf.) P. James & Gotth. Schneid. in Hawksworth & al., 1980, and H. sorophora (Vain.) P. James & Poelt in Poelt & Vĕzda, 1981). Timdal (1984a) revised Hypocenomyce and added four more species to it (H. australis Timdal, H. castaneocinerea (Räsänen) Timdal, H. foveata Timdal, and H. praestabilis (Nyl.) Timdal). He recognized four groups of species within the genus, based on anatomical and chemical characters: the H. anthracophila-, H. friesii-, H. scalaris- and H. xanthococca-groups (Table 1). The characters uniting the four groups were found to be mainly morphological (thallus) and ecological, and he expressed doubts about the homogeneity of the genus. Abassi Maaf & Roux (1984) described H. stoechadiana Abassi & Cl. Roux, but that species is now placed in Waynea Moberg (Roux & Clerc, 1991) and is not treated further here. Santesson (in Moberg, 1986) described H. leucococca R. Sant. from sterile material, and its inclusion in Hypocenomyce seems to have been based on its general resemblance in morphology, secondary chemistry and ecology with species of the H. xanthococca-group. Hafellner (1993) placed H. anthracophila and H. foveata in the genus Biatora Fr., a view that was not supported by Printzen (1995) in his revision of the European species of Biatora. As mentioned above, Hafellner (in Hafellner & Türk, 2001) raised the H. xanthococca-group to the level of genus, but no new data were presented to support this arrangement and we hence include Pycnora in this study. Timdal (2001) described two new species (Hypocenomyce oligospora Timdal and H. sierrae Timdal) which in morphological (thallus shape) and anatomical (apothecial pigments, proper exciple, ascus type) characters seemed to bridge the H. friesii- and H. scalaris-groups and also shared the secondary chemistry (alectorialic acid) with the H. xanthococca-group. The two species are here regarded as representing a fifth group, the H. oligospora-group. Finally, Elix (2006, 2007) described two new species from Australia, H. isidiosa Elix and H. tinderryensis Elix, which may be placed in the H. friesii- and H. scalarisgroups, respectively. Aims. — Our aim with the present study was to test whether the suggested five species groups are supported by DNA sequence data, and to reveal their phylogeny. The molecular phylogenetic study of Wedin & al. (2005) only included two Hypocenomyce and two Pycnora species, which represent three of the five presumed Hypocenomyce s.l. subgroups. In the present study, we included DNA sequences data of all currently recognized species of Hypocenomyce (11 spp.) and Pycnora (4 spp.), some presumed relatives, and a broad taxon sampling of the entire Lecanoromycetes (the latter sequences obtained from public databases). Based on our molecular phylogenetic results, we propose several taxonomic and nomenclatural changes. MATERIALS AND METHODS Taxon sampling. — For this molecular phylogenetic and taxonomic study of Hypocenomyce, we used herbarium specimens of varying age (up to 45 years old) held at the following herbaria: ASU, CANB, O, and S. The Hypocenomyce s.l. specimens studied originated from Australia, Norway, Russia, Sweden and the U.S.A. We have extracted DNA from multiple specimens of all Hypocenomyce s.l. species (41 accessions in total) as well as selected species relevant for the phylogenetic placement of Hypocenomyce (i.e., Biatora: 1, Catillaria A. Massal.: 1, Elixia Lumbsch: 5, Ophioparma: 3, and Xylographa (Fr.) Fr.: 3). These numbers include four collections presumed to belong in Hypocenomyce (collected and sequenced as Hypocenomyce sp.), but, based on the DNA sequences, later identified as Elixia cretica T. Sprib. & Lumbsch (E. cretica, specimens 1 and 2) and a possibly new species of Elixia (Elixia sp., specimens 1 and 2). We generated 113 DNA sequences of the nuclear ribosomal internal transcribed spacer region (nrITS: ITS1, 5.8S, ITS2) and large subunit (nrLSU; partial), and the mitochondrial small subunit (mtSSU; partial). Corresponding sequences of additional taxa (covering most relevant Lecanoromycete taxa from family level and above) were obtained from GenBank. We have, mostly during previous studies, examined the morphology and the secondary chemistry of type specimens of all currently accepted species of Hypocenomyce s.l. with the exception of H. scalaris which has never been typified. Thin-layer chromatography (TLC) was performed in accordance with the methods of Culberson (1972), modified by Menlove (1974) and Culberson & Johnson (1982). See Appendix 1 for voucher information for all DNA extracted specimens. DNA extraction. — We crushed up to 5 mg of tissue (apothecia, if present) from 54 archived specimens in 2 mL plastic tubes with two tungsten carbide beads in each for 2 × 1.5 min at 23 Hz on a mixer mill (MM301, Retsch GmbH & Co., Haan, Germany). We extracted total DNA from the crushed samples using the E.Z.N.A SP Plant DNA Mini Kit (Omega Bio-tek, Inc., Norcross, Georgia, U.S.A.) according to the manufacturer’s manual. We performed additional steps related to the elution for increasing DNA yield (as suggested in the manual), such as eluting twice, using the first eluate also the second time, and Version of Record (identical to print version). 943 Bendiksby & Timdal • Polyphyletic Hypocenomyce pre-warming to 65°C for 5 min prior to spinning. We deposited all DNA aliquots used in the present study in the DNA tissue collection at The Natural History Museum, Oslo (O). PCR amplification and DNA sequencing. — We amplified DNA in 25 µL reactions using the AmpliTaq GOLD DNA polymerase buffer II kit (Applied Biosystems, Foster City, California, U.S.A.) containing 0.2 mM of each dNTP, 0.04% bovine serum albumen (BSA), 0.01 mM tetramethylammonium chloride (TMACl), 0.4 μM of each primer, and 2 μL unquantified genomic DNA. We performed all amplifications in a GeneAmp PCR System 9700 (Applied Biosystems) using the following cycling conditions: 95°C for 10 min, 32 (nrITS, nrLSU) or 34 (mtSSU) cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 1 min, followed by 72°C for 10 min and hold forever at 10°C. For DNA extracts that would not amplify using the above described approach, we amplified shorter fragments or used the replicate procedure described in Bendiksby & al. (2011). We designed 10 primers for the present study. All primers, which we used in various combinations and both as PCR and sequencing primers, are listed with references in Table 2. We purified the PCR products using 2 µL 10 times diluted ExoSAP-IT (USB Corporation, Santa Clara, California, U.S.A.) to 8 µL PCR product, incubating at 37°C for 45 min followed by 15 min at 80°C. Prepared amplicons for sequencing contained: 9 μL 0–30× diluted purified PCR product (depending on product strength) and 1 μL of 10 μM primer. Cycle sequencing was outsourced to the ABI laboratory at the Centre for Ecological and Evolutionary Synthesis, Department of Biology, University of Oslo, where the ABI BigDye Terminator sequencing buffer and v.3.1 Cycle Sequencing kit (Applied Biosystems) are used. Sequences were processed on an ABI 3730 DNA analyser (Applied Biosystems). We assembled and edited the sequences using SEQUENCHER v.4.1.4 (Gene Codes Corporation, Ann Arbor, Michigan, U.S.A.). See Appendix 1 for the TAXON 62 (5) • October 2013: 940–956 GenBank accession numbers of all sequences included in the present study. Alignment and phylogeny reconstructions. — We aligned the sequences using the “ClustalW/Multiple alignment” option in BioEdit v.7.0.9.0 (Hall, 1999) with subsequent manual adjustments. We analyzed the data using maximum likelihood, maximum parsimony and Bayesian inference phylogenetic methods. In order to check for gene-tree incongruence, we compared preliminary strict consensus trees from parsimony analyses of the three genetic regions. For selecting optimal models of nucleotide substitution for the various markers we used TreeFinder (Jobb & al., 2004). We performed maximum parsimony phylogenetic analyses using TNT (Goloboff & al., 2008) applying the traditional search option with equal character weights, gaps treated as missing (replaced with question marks prior to analysis), 1000 random entry order replicates saving 10 trees per replicate, and tree bisection reconnection (TBR) branch swapping. We performed parsimony jackknifing with 1000 replicates. We also did maximum likelihood bootstrapping (BS) using RAxML v.7.2.6 (Stamatakis, 2006) under the GTRCAT model with 500 replicates. For the BI phylogenetic analyses we used MrBayes v.3.2.1 (Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003) with priors set according to the output of TreeFinder. We determined posterior probabilities by running one cold and three heated chains for 12 to 20 million generations in parallel mode (the 134 and 166 accessions datasets, respectively, see below), saving trees every 1000th generation. We performed the analyses twice to check their convergence for the same topology. To test whether the Markov Chain converged, we monitored the average standard deviation of split frequencies (ASDSF), which should fall below 0.01 when comparing two independent runs. We discarded as burn-in the generations prior to the point where the ASDSF fell below 0.01 and summarized the remaining trees Table 2. List of primers used in the present study with primer sequence and references. DNA region Primer name / primer sequence 5′ → 3′ direction Reference nrITS ITS4 / TCCTCCGCTTATTGATATGC (rev) White & al., 1990 ITS5 / GGAAGTAAAAGTCGTAACAAGG(fwd) White & al., 1990 ITS6 / TAAGTTCAGCGGGTATCCCTA (rev) This study ITS-lichF / TGAATTGCAGAATTCAGTGAAT (fwd) This study ITS-lichR / ATTCACTGAATTCTGCAATTCA (rev) This study nrLSU mtSSU ITS-hypF / TCTTTGAACGCACATTGCGCC (fwd) This study ITS-hypR / GGCGCAATGTGCGTTCAAAGA (rev) This study LSU-hypF / CGCTGAACTTAAGCATATC (fwd) This study LSU-hypR / CTATCCTGAGGGAAACTTCG (rev) This study LSU-hypR2 / CTTGGTCCGTGTTTCAAGACG (rev) This study mitSSU1 / AGCAGTGAGGAATATTGGTC (fwd) Zoller & al., 1999 mitSSU3R / ATGTGGCACGTCTATAGCCC (rev) Zoller & al., 1999 mtSSU-hypF / AGCATTCCACCTCAAGAGTA (rev) This study mtSSU-hypR / TACTCTTGAGGTGGAATGCT (rev) This study Abbreviations: nrITS = nuclear ribosomal internal transcribed spacer; nrLSU = nuclear ribosomal large subunit; mtSSU = mitochondrial ribosomal small subunit; rev = reverse primer; fwd = forward primer. 944 Version of Record (identical to print version). Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 as a 50% majority-rule consensus tree. We used the Bioportal server, University of Oslo, Norway (http://www.bioportal.uio .no) for the RAxML analyses. RESULTS Sequences and alignments. — DNA sequences of all three genetic regions (nrITS, nrLSU, mtSSU) were successfully generated for most of the specimens extracted for this study, except for a few old and/or poor-quality specimens, from which only the nrITS region (or parts of it) could be amplified and sequenced using the methods described herein. GenBank sequences of the three genetic regions were always based on the same voucher specimen. The highly variable ITS1 of the nrITS region was treated as missing data for accessions for which character homology could not be hypothesized (indicated with † in Appendix 1). Lengths in basepairs (bp) of the aligned DNAregions were: 650 bp for the nrITS region, 905 bp for the nrLSU region, and 1037 bp for the mtSSU region. The best-fit nucleotide substitution models, as proposed by TreeFinder based on the AICc model selection criterion, were general time reversible with gamma distribution (GTR + G) for the nrLSU and mtSSU regions and J2 + G for the nrITS region. As no manual exists for implementing the J2 + G model in MrBayes, the GTR + G model was used for all three regions. The concatenated matrix of 2592 bp contained 1186 parsimony-informative characters. Analyses. — The preliminary parsimony analyses showed congruent gene trees, although resolved to various extents and at different levels (not shown). The nrITS increased resolution of the more recent speciation events, whereas the mtSSU and nrLSU provided resolution of the backbone relationships. The nrLSU was less informative than the mtSSU. We therefore analyzed a concatenated dataset of all three genetic regions (nrITS, nrLSU, mtSSU), 166 accessions, and 2592 bp (hereafter referred to as the 166 accession dataset). In the Bayesian analysis, the ASDSF had fallen to 0.004683 at termination (20 million generations), and the first 5000 trees (25%) were discarded as burn-in. The remaining trees were summarized as a Bayesian 50% majority-rule consensus tree, which is presented in Fig. 2. Since the ITS1 and ITS2 of the nrITS region included several alignment ambiguities, we also performed a Bayesian analysis of a dataset consisting of only the more conserved 5.8S part of the nrITS region in combination with the nrLSU and mtSSU regions. This dataset included 134 accessions (only accessions for which the mtSSU region was available) and 2081 bp (hereafter referred to as the 134 accession dataset). At 12 million generations, the ASDSF had fallen to 0.004653, and the analysis was terminated. We discarded as burn-in the first 3000 trees (50%), and summarized the remaining trees into a 50% majority-rule consensus tree (Electr. Suppl.: Fig. S1). The parsimony strict and jackknife consensus trees with tree statistics for both datasets are provided in the Electr. Suppl.: Fig. S2. The parsimony results were largely consistent with the Bayesian and likelihood results, and the resultant topologies from the 166 vs. the 134 accession datasets were highly similar (Fig. 2; Electr. Suppl.: Figs. S1–S2). The 15 included species of Hypocenomyce s.l. form seven strongly supported groups in our molecular phylogeny (Fig. 2; Electr. Suppl.: Figs. S1–S2). Through nucleotide BLAST searches at NCBI (http://www.ncbi.nlm.nih.gov/), it became clear that the seven groups were far from being each other’s closest relatives, and a broad taxonomic sampling had to be included in order to place these groups phylogenetically. The resultant phylogeny shows that the Hypocenomyce species belong in different families, orders and even different subclasses (Fig. 2). The backbone of the phylogeny (the oldest speciation events) received poor support from parsimony jackknifing (Electr. Suppl.: Fig. S2), and the parsimony strict consensus trees were partly incongruent with the Bayesian majority-rule trees (Fig. 2; Electr. Suppl.: Fig. S1). The incongruences (indicated with asterisks on Fig. 2) mainly concerned long-branch taxa in the Ostropomycetidae and the Lecanoromycetidae. The backbone support was generally higher with likelihood bootstrapping (Fig. 2). See the Discussion for other relevant aspects of our phylogenetic results. The concatenated alignment of 166 accessions and three genetic regions and the resultant Bayesian phylogenetic tree are provided as supplementary material. DISCUSSION Although Hypocenomyce s.l. (including Pycnora) has been extensively studied by anatomical and chemical approaches (e.g., Timdal, 1984a, 2001, 2002; Elix, 2009), the present study is the first comprehensive molecular phylogenetic investigation of the genus. Our aim has been to investigate phylogenetic relationships among the 15 species of Hypocenomyce s.l. and to test hypotheses about the presumed groups among them (Table 1). Our phylogenetic results (Fig. 2), based on three DNA regions of various levels of molecular divergence from two different genomes and with a broad taxonomic sampling, reveal that Hypocenomyce s.l. is extremely polyphyletic. Although the backbone of the phylogeny (the oldest speciation events) mostly receives moderate support from likelihood bootstrapping (Fig. 2) and parsimony jackknifing (Electr. Suppl.: Fig. S2), the Bayesian majority-rule consensus topology (Fig. 2) corresponds well with all recently published phylogenetic hypothesis (Wedin & al., 2005; Miądlikowska & al., 2006; Hofstetter & al., 2007; Lumbsch & al., 2007; Ekman & al., 2008; Schoch & al., 2009; Schmull & al., 2011) that have included similar sets of taxa, but without the present extensive sampling of Hypocenomyce s.l. The five presumed subgroups (see Introduction and Table 1) are mostly supported by our molecular data, but two species, H. isidiosa and P. leucococca, form independent groups remotely positioned from any of the other groups (Fig. 2B). The resultant seven subgroups are surprisingly distantly related and clearly belong in different genera, families, orders and even subclasses. Further below, we discuss the Hypocenomyce subgroups and their phylogeny, and we Version of Record (identical to print version). 945 Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 undertake several taxonomic changes that are now supported by multiple sources of evidence. In the following paragraph, “Morphological convergence”, we use the new taxonomy proposed (see Nomenclatural novelties for author names). Fig. 2A (for Fig. 2B see next page) 1 Umbilicaria africana 1 Umbilicaria aprina 100 1 95 Umbilicaria proboscidea 1 Umbilicaria spodochroa 82 Umbilicaria crustulosa 100 1 Lasallia pennsylvanica 1 100 1 96 65 91 Lasallia pustulata 100 H. friesii 2 .99 H. friesii 3 93 H. friesii 4 1 H. caradocensis 1 1 63 1 100 H. caradocensis 2 78 H. caradocensis 3 99 54 Xylopsora gen. nov. H. friesii 1 H. oligospora 1 (holotype) Umbilicariaceae .96 1 H. oligospora 2 Acarosporomyceidae → Elixiaceae Ophioparmaceae Fuscideaceae i.s. Acarosporaceae Aca. Pycnoraceae fam. nov. Candelariaceae Candelariales “Candelariomyceidae” (sensu Miądlikowska & al., 2006) → H. oligospora 4 Fulgidea gen. nov. 1 98 H. oligospora 3 1 H. sierrae 1 100 1 100 H. sierrae 2 (holotype) 74 86 Elixia flexella 2 .98 Elixia flexella 3 .97 77 Elixia flexella 1 77 .92 Elixia sp. 1 U.S.A. .97 90 Elixia sp. 2 U.S.A. .97 Elixia cretica 1 AUSTRALIA 1 1 1 91 Elixia cretica 1 MEXICO 92 75 Elixia cretica 3 CRETE (holotype) 100 Meridianelia maccarthyana (isotype) .95 H. tinderryensis 2 1 H. tinderryensis 3 68 74 H. australis 1 H. australis 2 1 H. australis 3 (isotype) H. australis 4 100 H. tinderryensis 1 Hypocenomyce H. tinderryensis 4 (holotype) 1 H. tinderryensis 5 97 H. scalaris 1 1 1 H. scalaris 3 1 89 H. scalaris 4 94 1 H. scalaris 5 97 H. scalaris 2 97 1 Ophioparma ventosa 1 1 Ophioparma ventosa 2 100 1 Ophioparma lapponica 98 Ophioparma handelii 58 98 Boreoplaca ultrafrigida (holotype) 1 Fuscidea mollis 100 Maronea constans Myriospora smaragdula .9 Pleopsidium flavum 1 Acarospora peliscypha 1 58 Sarcogyne privigna 98 100 Pleopsidium gobiense H. xanthococca 1 1 H. xanthococca 2 H. xanthococca 3 100 H. sorophora 5 H. sorophora 2 1 Pycnora H. sorophora 1 67 100 .97 H. sorophora 3 1 85 H. sorophora 4 H. praestabilis 2 98 H. praestabilis 1 1 Candelariella coralliza 59 1 Candelariella vitellina 96 1 100 Candelariella aurella 1 92 1 Candelariella reflexa Candelariella terrigena 96 100 Candelaria concolor Geoglossum nigritum Umbilicariales Umbilicariomyceidae subcl. nov. → .98 Morphological convergence. — Traditional classifications are based largely on morphological and ecological aspects of organisms. Since the early 1990s, molecular phylogenetics has revolutionized the field of systematics, in particular in the 0.09 Fig. 2. The 50% majority-rule consensus phylogram (2A above, 2B next page) from a Bayesian analysis of a concatenated matrix with 166 accessions and 2592 basepairs from two nuclear (ITS and LSU) and one mitochondrial (SSU) ribosomal DNA region. The Bayesian posterior probability values of at least 0.9 are reported above branches, and maximum likelihood bootstrap values of at least 50% are reported below branches. Asterisks indicate incongruent topology with parsimony results (see Electr. Suppl.: Fig. S2). Multiple accessions of the same species are numbered according to Appendix 1. The Hypocenomyce s.l. accessions are in bold. One branch was manually shortened to reduce the size of a broad figure (indicated with a black dot). Names to the right of branches indicate the classification as supported herein. Taxonomic changes undertaken in the present study from genus and above are also in bold face. — Aca., Acarosporales; i.s., incertae sedis; Ost., Ostropales; Pel., Peltigerales; Tel., Teloschistales. 946 Version of Record (identical to print version). Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 11 99 99 11 87 87 11 85 85 11 98 98 Lecanoromyceidae → Tel. Pel. i.s. Baeomycetales 11 80 80 Lecanorales Ost. Ostropomyceidae → i.s. Pertusariales Cladonia Cladonia rangiferina rangiferina Metus Metus conglomeratus conglomeratus Pilophorus Pilophorus strumaticus strumaticus* Cladia Cladoniaceae Cladia retipora retipora 11 Heterodea Heterodea muelleri muelleri Stereocaulon paschale 97 Stereocaulon paschale 97 Stereocaulaceae Lepraria Lepraria lobificans lobificans 11 H. H. castaneocinerea castaneocinerea 11 11 97 97 H. H. castaneocinerea castaneocinerea 22 72 72 Carbonicolaceae 11 H. H. anthracophila anthracophila 11 .96 .96 Carbonicola 100 H. anthracophila Carbonicola gen. nov. 100 H. anthracophila 2 2 fam. nov. 11 11 H. H. anthracophila anthracophila 33 H. anthracophila 44 100 100 H. anthracophila 100 100 11 H. H. foveata foveata 11 Lecanora Lecanora polytropa polytropa Rhizoplaca 92 Rhizoplaca chrysoleuca chrysoleuca 92 Lecanora Lecanora sulphurea sulphurea Lecanoraceae Pyrrhospora Pyrrhospora quernea quernea .99 .99 Lecanora Lecanora carpinea carpinea Lecidella Lecidella euphorea euphorea Haematomma Haematomma ochroleucum ochroleucum 11 Myelochroa Myelochroa aurulenta aurulenta Parmelina quercina 100 Parmelina quercina 100 11 Parmeliaceae Evernia prunastri Evernia prunastri .96 .96 100 100 Bryoria Bryoria capillaris capillaris Gypsoplaca Gypsoplaca macrophylla macrophylla (Gypsoplacaceae) (Gypsoplacaceae) 11 Mycoblastus Mycoblastus sanguinarius sanguinarius Mycoblastaceae Tephromela atra Tephromela atra 92 92 11 Biatora .99 Biatora vernalis vernalis .99 Crocynia Crocynia pyxinoides 97 97 67 67 11 Ramalina Ramalina complanata complanata 11 Ramalinaceae Megalaria Megalaria grossa grossa 86 86 59 59 11 Toninia sedifolia 11 Bacidia 73 Bacidia rubella rubella 73 56 56 11 Sphaerophorus Sphaerophorus globosus globosus Sphaerophoraceae .97 .97 11 Neophyllis melacarpa Neophyllis melacarpa 95 95 11 Protoblastenia Protoblastenia rupestris rupestris 62 62 Psoraceae Psora Psora decipiens decipiens 83 83 .92 .92 Scoliciosporum Scoliciosporum umbrinum umbrinum (Scoliciosporaceae) (Scoliciosporaceae) Calopadia Calopadia sp. sp. 11 Micarea Micarea adnata adnata Pilocarpaceae Psilolechia Psilolechia leprosa leprosa Lopadium Lopadium disciforme (i.s.) .91 .91 Catillaria Catillaria chalybeia chalybeia Caillariaceae Solenopsora Solenopsora holophaea holophaea 11 Xanthoria Xanthoria parietina parietina Teloschistaceae 11 Teloschistes Teloschistes flavicans flavicans 100 100 11 Peltigera praetextata (Peltigeraceae) 84 84 97 Nephroma arcticum (Nephromelataceae) 97 Nephroma 11 Porpidia Porpidia speirea speirea 11 .99 .99 Lecidea Lecidea atrobrunnea atrobrunnea 99 99 11 Lecideaceae 83 83 52 52 Lecidea Lecidea tessellata tessellata 93 93 Porpidia Porpidia macrocarpa macrocarpa 11 11 Rhizocarpon Rhizocarpon oederi oederi Rhizocarpaceae 82 82 Catolechia 100 Catolechia wahlenbergii wahlenbergii 100 11 H. H. leucococca leucococca 11 Toensbergia Toensbergia gen. nov. 11 H. Sporastaiaceae H. leucococca leucococca 22 100 100 11 Sporastatia Sporastatia polyspora polyspora 92 92 fam.nov. Sporastatia Sporastatia testudinea testudinea 96 96 Xylographa Xylographa parallela parallela 11 Xylographa Xylographa soralifera soralifera 67 67 11 95 95 Xylographa Xylographa trunciseda trunciseda Xylographa Xylographa 11 H. H. isidiosa isidiosa 11 (isotype) (isotype) 99 99 H. isidiosa 2 H. isidiosa 2 100 100 69 69 Xylographa Xylographa opegraphella opegraphella .94 70 .94 70 Trapeliaceae Rimularia psephota psephota Rimularia 64 64 Ptychographa xylographoides xylographoides Ptychographa 11 11 Orceolina kerguelensis kerguelensis Orceolina 11 Placopsis santessonii santessonii Placopsis 100 100 85 85 11 100 100 Trapelia placodioides placodioides Trapelia 11 97 97 Placynthiella uliginosa uliginosa* Placynthiella 95 95 Trapeliopsis granulosa granulosa* Trapeliopsis 11 Baeomyces rufus rufus Baeomyces Baeomycetaceae Ainoa mooreana Ainoa mooreana 68 68 Tremolecia atrata Tremolecia atrata 11 (i.s.) Hymeneliaceae Hymenelia lacustris lacustris Hymenelia 11 Graphis scripta scripta Graphis 11 Thelotrema suecicum 96 96 .92 .92 Diploschistes scruposus scruposus 100 Diploschistes 100 Graphidaceae Protothelenella sphinctrinoidella sphinctrinoidella (Protothelenellaceae) (Protothelenellaceae) Protothelenella .99 .99 Gregorella humida humida Gregorella .93 .93 11 Wawea fruticulosa fruticulosa 71 Arctomiaceae Wawea 71 100 100 Arctomia delicatula delicatula Arctomia 11 Miltidea ceroplasta ceroplasta (Miltideaceae) (Miltideaceae) Miltidea 11 Agyrium rufum rufum (Agyriaceae) (Agyriaceae) 84 Agyrium 84 .92 .92 99 99 Pertusaria leioplaca leioplaca (Pertisariaceae (Pertisariaceae I) Pertusaria .97 Coccotrema cucurbitula cucurbitula (Coccotremataceae) .97 Coccotrema .93 .93 Thamnolia vermicularis vermicularis (Icmadophilaceae) (Icmadophilaceae) Thamnolia 63 63 1 1 Lobothallia radiosa radiosa Lobothallia Megasporaceae 11 100 Aspicilia cinerea cinerea 100 Aspicilia 11 Ochrolechia parella (Ochrolechiaceae) Ochrolechia parella (Ochrolechiaceae) 83 83 60 60 Pertusaria dactylina dactylina (Pertusariaceae (Pertusariaceae II) II) 100 Pertusaria 100 Schaereria fuscocinerea fuscocinerea (Schaereriaceae) (Schaereriaceae) Schaereria Loxospora ochrophaea ochrophaea (Sarrameniaceae) (Sarrameniaceae) Loxospora Fig. Fig. 2B 2B i.s. 11 for Fig. Fig. 2A 2A for see previous previous page page see 0.09 0.09 Version of Record (identical to print version). 947 Bendiksby & Timdal • Polyphyletic Hypocenomyce most taxonomically challenging groups. Fungi (incl. lichenized fungi) represent one such taxonomically challenging group due to few phenotypic characters and a high level of homoplasy. Hence, fungal molecular phylogenies have resulted in numerous novel classifications (e.g., Lutzoni & al., 2004; James & al., 2006; Miądlikowska & al., 2006; Hibbet & al., 2007; Schoch & al., 2009) and revealed numerous instances of convergent evolution (see Rivas Plata & Lumbsch, 2011, and references therein; Rivas Plata & al., 2012). Our phylogeny shows that the great morphological and ecological similarity between the former Hypocenomyce species is the result of convergence in seven clades. Brown, squamulose thalli, often geotropically arranged and with lip-shaped soralia, occur in Carbonicola, Hypocenomyce, Fulgidea, and Xylopsora. Ten species in five clades occur on burnt wood (Carbonicola, all species; Fulgidea, all species; Hypocenomyce, all species; Xylographa isidiosa; and Xylopsora friesii). We have observed that very few crustose lichen species grow on burnt wood in northern Europe. In addition to Hypocenomyce, these are mainly Chaenotheca ferruginea (Sm.) Mig., Hertelidea botryosa (Fr.) Printzen & Kantvilas, Micarea melaenida (Nyl.) Hedl., and Trapeliopsis flexuosa (Fr.) Coppins & P. James. The presence of four clades containing such ecological specialists in the Umbilicariales (Elixia, Fulgidea, Hypocenomyce, Xylopsora) may be explained as a plesiomorphy in this order, in which case the saxicolous genera Boreoplaca, Lasallia Mérat, and Umbilicaria have evolved from ancestors growing on burnt wood. Alternatively, the specialized ecology is a homoplasy and evolved up to four times in the order, or the topology in our Umbilicariales phylogeny does not correctly reflect the evolution of the four clades. Abundant production of apparently persistently immature asci occurs in Hypocenomyce (all three species) and Fulgidea (F. oligospora), and must be a homoplasy of the two genera. The selective forces behind this character state remain obscure. In H. scalaris and H. tinderryensis it may be viewed as an incomplete step in reduction of fertility as a response to the species having switched to vegetative dispersal (soredia), but in the two other species (H. australis, F. oligospora) no vegetative dispersal units are produced and they should rely only on ascospore dispersal. We suggest an ecological study of the effect of heat from forest fire on spore production in those species. The chemical similarity between Pycnora and Toensbergia (alectorialic acid) and between Xylopsora and Xylographa isidiosa (confriesiic/friesiic acids) are clearly homoplasies. The Hypocenomyce anthracophila-group. — There are no previously published sequences or phylogenies of species in this group. In our results (Fig. 2B; Electr. Suppl.: Figs. S1–S2), the three species comprising the H. anthracophilagroup (H. anthracophila, H. castaneocinerea, H. foveata) form a monophyletic clade within the order Lecanorales. The H. anthracophila-group clearly does not belong in any of the lecanoralean families included in the present phylogeny (i.e., Catillariaceae, Cladoniaceae, Gypsoplacaceae, Haematommataceae, Lecanoraceae, Mycoblastaceae, Parmeliaceae, Pilocarpaceae, Psoraceae, Ramalinaceae, Scoliciosporaceae, Sphaerophoraceae, Stereocaulaceae). We do not have sequence data for 948 TAXON 62 (5) • October 2013: 940–956 the remaining currently accepted families of the Lecanorales (Biatorellaceae, Calycidiaceae, Dactylosporaceae, Pachyascaceae). However, judging from anatomical characters, especially the ascus type, the H. anthracophila-group does not belong in any of these families. In the Biatorellaceae, the asci are polysporous and have a well-developed, weakly amyloid tholus which lacks an amyloid tube (Hafellner & Casares-Porcel, 1992). In the Pachyascaceae, the asci are surrounded by a thick, amyloid gelatinous wall; a small, weakly amyloid tholus, apparently without any tube structure, may be developed in young asci (Grube, 2002). In the Calycidiaceae the asci are prototunicate and disintegrate early as a part of the formation of a mazaedium (Tibell, 1984). In the Dactylosporaceae the asci lack a tholus and are apically covered by a thick gelatinous sheet; the ascospores are brown and septate (Bellemere & Hafellner, 1982). The sister clade of the H. anthracophila-group is the clade consisting of the Cladoniaceae and Stereocaulaceae. As long as these two families are kept separate, a new family is needed for the H. anthracophila-group. Hence, we describe a new genus (Carbonicola Bendiksby & Timdal) and a new family (Carbonicolaceae) for this clade (see Nomenclatural novelties, below). Within the clade, H. foveata is a sister to H. anthracophila and H. castaneocinerea (Fig. 2B). Hypocenomyce anthracophila seems to be genetically heterogeneous, as indicated by two distinct clades among the four accessions included (Fig. 2B) and should be studied further for a possible phenotypically cryptic species. Molecular approaches to systematics of lichenforming fungi have revealed a substantial number of unrecognized fungal species hidden within traditional phenotype-based species (Crespo & Lumbsch, 2010; Lumsch & Leavitt, 2011; Leavitt & al., 2012). Note that our type studies have shown that the species epithet “myrmecina” should replace “castaneocinerea” (see Nomenclatural novelties, below). The Hypocenomyce friesii- and H. oligospora-groups. — The only previously published phylogenetic study of species in these groups is that of Wedin & al. (2005), who found H. friesii to be sister to three Umbilicaria species and more distantly related to H. scalaris. Our phylogenetic results support their conclusion: H. caradocensis and H. friesii form a monophyletic group which is supported as sister to a clade consisting of seven species of Lasallia and Umbilicaria (Fig. 2A; Electr. Suppl.: Figs. S1–S2). Hypocenomyce friesii appears paraphyletic in our phylogeny and should be studied further for a possible phenotypically cryptic species. The morphology of the H. friesii-group differs significantly from the saxicolous, umbilicate-foliose lichens of Umbilicaria and Lasallia. We therefore describe the new genus Xylopsora Bendiksby & Timdal for the H. friesii-group (see Nomenclatural novelties, below). Hypocenomyce isidiosa, which is not known with apothecia, was originally thought to be related to H. friesii because of its similar secondary chemistry (the rare compounds confriesiic and friesiic acids) and its substrate preference (burnt wood; Elix, 2006). However, our molecular results show that H. isidiosa is not closely related to Xylopsora but rather nests within Xylographa (Trapeliaceae, Baeomycetales, Ostropomycetidae; Fig. 2B). Morphologically, H. isidiosa resembles Version of Record (identical to print version). Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 sorediate species of Xylographa in forming an endoxylic thallus with vegetative dispersal units bursting out through cracks in the wood (Fig. 1M). Confriesiic acid occurs in two other genera of the Trapeliaceae, i.e., Rimularia Nyl. and Trapeliopsis Hertel & Gotth. Schneid. Hence, we propose the new combination Xylographa isidiosa (Elix) Bendiksby & Timdal (see TNomenclatural novelties, below). The H. oligospora-group forms a monophyletic group moderately supported as sister to the Xylopsora-LasalliaUmbilicaria-clade (Fig. 2A; Electr. Suppl.: Figs. S1–S2). But as the H. oligospora-group cannot be placed in Xylopsora without making it paraphyletic, and lumping Xylopsora with Lasallia and Umbilicaria seems impossible, we describe the new genus Fulgidea Bendiksby & Timdal for the H. oligospora-group (see Nomenclatural novelties, below). Moreover, we suggest that Fulgidea and Xylopsora are included in the Umbilicariaceae. Thus, the concept of the previously exclusively foliose family Umbilicariaceae is extended to include crustose and squamulose genera. We find this not unreasonable as we believe thallus growth form is not a character of great importance at the family level (compare, e.g., the current concept of the Physciaceae, Ramalinaceae and Teloschistaceae; Lumbsch & Huhndorf, 2010). Whether the Elixiaceae (which consists of only three known species) should be accepted as a separate family is here left for future studies. But when Fulgidea and Xylopsora are included in the Umbilicariaceae, there are hardly any morphological, anatomical, or ecological arguments for accepting the Elixiaceae. Note that two specimens growing on burnt wood and identified as Hypocenomyce sp. in our study were identified as Elixia cretica (Fig. 2A: Elixia cretica 1 and 2) and represent the first report of this species, recently described from Greece (Spribille & Lumbsch, 2010), in North America and Australia. Two additional collections (Fig. 2A: Elixia sp., specimen 1 and 2) may represent a new species of Elixia (see Appendix 1 for voucher information). The Hypocenomyce scalaris-group. — Our molecular phylogenic results support the monophyly of the H. scalaris-group, consisting of H. australis, H. scalaris, and H. tinderryensis (Fig. 2A; Electr. Suppl.: Figs. S1–S2). The separation of H. tinderryensis from H. australis is, however, not supported and should be studied further. The H. scalaris-group is sister to a clade consisting of Boreoplaca and Ophioparma (Fig. 2A), corroborating previous findings by Wedin & al. (2005) and Miądlikowska & al. (2006; although with a different internal topology). The circumscription of Hypocenomyce should hence be restricted to the H. scalaris-group (see Nomenclatural novelties, below). Our phylogeny further supports a sister-relationship of the Hypocenomyce-Boreoplaca-Ophioparma clade (Ophioparmaceae) with the Umbilicariaceae-Elixiaceae clade (Fig. 2A), partly corroborating the phylogenetic topologies published by Wedin & al. (2005) and Miądlikowska & al. (2006). In Miądlikowska & al. (2006), Fuscideaceae was sister to the Ophioparmaceae (and this group again sister to the Umbilicariaceae), a sister-relationship neither supported nor strongly contradicted by our data (Fig. 2A; Electr. Suppl.: Figs. S1–S2). Miądlikowska & al. (2006) considered the FuscideaceaeOphioparmaceae-Umbilicariaceae clade as the Umbilicariales, and noted that the subclass Umbilicariomycetidae should be considered for this group in the future. Regardless, Lumbsch & Huhndorf (2010) and Hodkinson (2012) kept the Umbilicariales among the Lecanoromycetes orders incertae sedis. Lumbsch & Huhndorf (2010) placed the Fuscideaceae and the Ophioparmaceae among the Lecanoromycetidae families incertae sedis, whereas Hodkinson (2012) recognized their inclusion in the Umbilicariales. Our phylogenetic results, with increased taxon sampling, support a clade consisting of the Elixiaceae, Ophioparmaceae and Umbilicariaceae (Fig. 2A; Electr. Suppl.: Figs. S1–S2). We refer to this clade as the Umbilicariales and the Umbilicariomycetidae subcl. nov. in this paper (see Nomenclatural novelties, below). We leave it to future more comprehensive studies to consider the inclusion of the Fuscideaceae in the Umbilicariomycetidae, but would like to point out that our microscopical examination of asci in Umbilicaria revealed a type similar to the Fuscidea-type, i.e., with amyloid layers lining both the inside and outside of the ascus wall near its apex. The Hypocenomyce xanthococca-group (Pycnora). — In Wedin & al. (2005), Pycnora sorophora and P. xanthococca formed a strongly supported group that was sister to the Acarosporaceae (parsimony) or Candelariaceae (Bayesian). In our phylogeny (Fig. 2A), which includes multiple accessions of all four Pycnora species, all, except P. leucococca, form a strongly supported clade. The already existing name for the H. xanthococca-group, Pycnora, hence comprises the three species P. praestabilis (Nyl.) Hafellner, P. sorophora, and P. xanthococca (see Nomenclatural novelties, below). Our phylogenetic results support a sister-relationship between Pycnora and the Candelariaceae (Fig. 2A; Electr. Suppl.: Figs. S1–S2), corroborating the Bayesian results by Wedin & al. (2005). Although only representatives from two Candelariaceae genera have been included here (i.e., Candelaria A. Massal. and Candelariella Müll. Arg.), Westberg & al. (2007) showed that the family also comprises the two genera Candelina Poelt and Placomaronea Räsänen. We believe differences in the secondary chemistry (pulvinic acid derivatives vs. dibenzofurans) and in the apothecia (lecanorine and biatorine vs. lecideine) between the Candelariaceae and Pycnora justify placing the latter in the new family Pycnoraceae, and we include it in the order Candelariales. This order may be placed in the “Candelariomycetidae” (nom. inval.). Our results (Fig. 2) support the previously published finding that the Candelariales is distinct from the Lecanorales (Wedin & al., 2005; Miądlikowska & al., 2006; Hofstetter & al., 2007; Lumbsch & al., 2007); a finding that made Lumbsch & Huhndorf (2010) place Candelariales among the Lecanoromycetes orders incertae sedis. The six-gene phylogenetic results by Schoch & al. (2009: fig. 3), however, shed doubts on whether Candelariales at all belong in the Lecanoromycetes. Based on the phylogenetic results by both Miądlikowska & al. (2006) and Schoch & al. (2009), Hodkinson (2012) recognized the “Subclass Candelariomycetidae”, but, no formal description has been provided (see Nomenclatural novelties, below). Our Version of Record (identical to print version). 949 Bendiksby & Timdal • Polyphyletic Hypocenomyce restricted ascomycote taxon sampling does not provide information about the phylogenetic placement of “Candelariomycetidae”, but in the six-gene Ascomycota tree by Schoch & al. (2009), Candelariales fell outside all well-supported classes in superclass Leotiomyceta (sensu Eriksson & Winka, 1997). Pycnora sorophora seems to be a polyphyletic species (Fig. 2A). We hypothesize that this species evolved as a sorediate taxon from both P. praestabilis and P. xanthococca. This should be investigated further with more accessions and a better geographic coverage of all three species. The fourth species of the H. xanthococca-group, Pycnora leucococca (R. Sant.) R. Sant., occurs remotely from the other Pycnora species in the phylogeny (Fig. 2B). Pycnora leucococca groups with strong support with two accessions of the genus Sporastatia A. Massal. (Fig. 2B; Electr. Suppl.: Figs. S1–S2). In Miądlikowska & al. (2006), a clade consisting of Rhizocarpaceae and Sporastatia was recovered and supported. This relationship was not recovered here. In the present study, the P. lecococca–Sporastatia clade is sister group to Rhizocarpaceae plus all remaining members of subclass Lecanoromycetidae (Fig. 2B; Electr. Suppl.: Figs. S1–S2). It should be noted, however, that regardless of the placement of Rhizocarpaceae, the phylogenetic results support the removal of Sporastatia from the Catillariaceae (Lecanorales; Fig. 2B; Electr. Suppl.: Figs. S1–S2; Miądlikowska & al., 2006). Fruiting bodies are not known in P. leucococca, but from a morphological and ecological point of view, it seems impossible to include P. leucococca in Sporastatia. Hence, we describe a new genus, Toensbergia Bendiksby & Timdal, for this species and place it in the new family Sporastatiaceae based on our molecular phylogenetic results (see Nomenclatural novelties, below). NOMENCLATURAL NOVELTIES “Candelariomycetidae” Miądl. & al. in Mycologia 98: 1091. 2006, nom. inval. (Art. 39.1). See Fig. 2A and Electr. Suppl. Fig. S1 for clade “Candelariomycetidae” as applied to by Miądlikowska & al. (2006). Candelariales Miądl., Lutzoni & Lumbsch in Mycol. Res. 111: 530. 2007. Pycnoraceae Bendiksby & Timdal, fam. nov. [MB 804835] – Type: Pycnora Hafellner. Diagnostic characters. – The Pycnoraceae is the clade sister to the Candelariaceae and differs in forming lecideine, black apothecia with consistently octosporous asci and consistently simple ascospores, and in the secondary chemistry of dibenzofurans (alectorialic acid). In the Candelariaceae, the apothecia are lecanorine or biatorine, yellow to orange, the asci are often polysporous, the ascospores often septate, and the secondary chemistry consists of pulvinic acid derivatives. Pycnora Hafellner in Stapfia 76: 157. 2001 – Type: Pycnora xanthococca (Sommerf.) Hafellner. 950 TAXON 62 (5) • October 2013: 940–956 Included species. – Pycnora praestabilis (Nyl.) Hafellner, P. sorophora (Vain.) Hafellner, P. xanthococca (Sommerf.) Hafellner. Lecanoromycetidae Miądl., Lutzoni & Lumbsch in Mycol. Res. 111: 529. 2007. Lecanorales Nannf. in Nova Acta Regiae Soc. Sci. Upsal., ser. 4, 8(2): 68. 1932. Carbonicolaceae Bendiksby & Timdal, fam. nov. [MB 804836] – Type: Carbonicola Bendiksby & Timdal. Diagnostic characters. – The Carbonicolaceae is the clade sister to a clade consisting of the Cladoniaceae and Stereocaulaceae. It differs from those families in forming a purely crustose to squamulose, dark brown thallus with a thick, shiny upper cortex, and in having a strong preference for the substrate charred wood and bark. The core genera of the Cladoniaceae and Stereocaulaceae form a fruticose secondary thallus, which is absent in the Carbonicolaceae. Carbonicola Bendiksby & Timdal, gen. nov. [MB 804837] – Type: Carbonicola anthracophila (Nyl.) Bendiksby & Timdal. Diagnostic characters. – Thallus squamulose, adnate or ascending and geotropically oriented, (greenish to) medium to dark brown, shiny, epruinose, without hypothallus. Apothecia brown, convex, weakly marginate when young, soon becoming immarginate, epruinose; exciple composed of conglutinated, thick-walled hyphae with thread-like lumina, colorless in inner part, pale brown in the rim, K−, N−, lacking crystals; epihymenium brown, N−, without amorphous substances; ascus clavate, octosporous, without an apical amyloid cap, with a welldeveloped, amyloid tholus containing a deeper amyloid tube. Pycnidium wall brown, N−; pycnoconidia filiform. Chemistry: colensoic acid, 4-O-methylphysodic acid and related compounds (in all species), fumarprotocetraric and protocetraric acid (in C. anthracophila). Etymology. – The name refers to its preferred substrate, burnt wood (lat. carbo: charcoal, -cola: dweller). Notes. – The genus differs from the other genera formerly included in Hypocenomyce in having brown, convex, more or less immarginate apothecia; a pale exciple composed of entirely conglutinated hyphae; a brown epihymenium lacking amorphous substances; asci with a deeply amyloid tube; and in the main secondary chemistry consisting of compounds of the colensoic acid complex. Biatora, in which Hafellner (1993) placed two Carbonicola species, differs mainly in forming a crustose or at most a subsquamulose thallus and in having a conical amyloid zone in the tholus (ascus of Bacidia-type, typical of the Ramalinaceae). Carbonicola anthracophila (Nyl.) Bendiksby & Timdal, comb. nov. [MB 804838] ≡ Lecidea anthracophila Nyl. in Flora 48: 603. 1865 ≡ Psora anthracophila (Nyl.) Arnold in Flora 53: 471. 1870 ≡ Biatora anthracophila (Nyl.) Tuck., Syn. N. Amer. Lich. 2: 14. 1888 ≡ Hypocenomyce Version of Record (identical to print version). Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 anthracophila (Nyl.) P. James & Gotth. Schneid. in Biblioth. Lichenol. 13: 81. 1980 ≡ Biatora anthracophila (Nyl.) Hafellner in Herzogia 9: 729. 1993 – Lectotype (designated by Timdal, 1984a): Finland, “Evois ad lignium [sic!] carbonatum”, 1865, J.P. Norrlin s.n. (H-NYL No. 20375 p.p.!) = Psora cladonioides var. albocervina Räsänen, Lichenes Fenniae Exsiccati: No. 281. 1936 ≡ Lecidea cladonioides var. albocervina (Räsänen) Zahlbr., Cat. Lich. Univ. 10: 346. 1939– Lectotype (designated here): Finland, Karelia borealis, Pielisjärvi, Louhivaara, ad orientem versus ab lacu Ylinen Pitkäjärvi, ad lignum vetustum carbonatum trunci erecti altique Pini silvestris in pineto aprico deserto, July 1936, M. Laurila s.n. = Räsänen, Lichenes Fenniae Exsiccati No. 281 (O No. L-894!; isotypes: BM!, S!, UPS No. L-533305!). = Lecidea cladonioides Fr. ex Th. Fr., Lichenogr. Scand.: 417. 1874, nom. illeg. superfl. (nomenclaturally superfluous name for L. anthracophila Nyl.; Art. 52.1) ≡ Psora cladonioides (Th. Fr.) Elenkin, Fl. Lishaynikov Sredney Rossii [Lichenes Florae Rossiae Mediae] 2: 345. 1907. – “Biatora ostreata var. cladonioides” Fr., Summa Veg. Scand.: 111. 1845, nom. nud. Carbonicola foveata (Timdal) Bendiksby & Timdal, comb. nov. [MB 804840] ≡ Hypocenomyce foveata Timdal in Nordic J. Bot. 4: 98. 1984 ≡ Biatora foveata (Timdal) Hafellner in Herzogia 9: 729. 1993 – Holotype: Australia, Victoria, Cultivation Creek, Billywing area, Western Grampians, 37°15′ S, 142°16′ E, August 1981, H. Krog Au1401 (O No. L-50!). Carbonicola myrmecina (Ach.) Bendiksby & Timdal, comb. nov. [MB 804841] ≡ Lecidea scalaris var. myrmecina Ach., Methodus: 78. 1803 ≡ Lecidea myrmecina (Ach.) Fr. in Kongl. Vetensk. Akad. Handl. 1822: 257. 1822 ≡ Parmelia ostreata var. myrmecina (Ach.) Torss., Enum. Lich. Byssacearum Scand.: 14. 1843 ≡ Lecidea ostreata var. myrmecina (Ach.) Nyl., Lich. Scand.: 243. 1861 ≡ Psora ostreata var. myrmecina (Ach.) Th. Fr. in Nova Acta Regiae Soc. Sci. Upsal., ser. 3, 3: 269. 1861 ≡ Psora myrmecina (Ach.) Boistel, Nouv. Fl. Lich. 2: 94. 1902 ≡ Psora scalaris var. myrmecina (Ach.) Räsänen, Lichenes Fenniae Exsiccati: No. 825. 1943 – Lectotype (designated here): [s. loco], “Parmelia (Psoroma) myrmecina, e collect. cel. Acharii accepi” [scrips. G. Wahlenberg], ex herb. G. Wahlenberg (UPS-ACH No. 256!). Probable isolectotypes: [s. loco], ex herb. Agrelius (UPS-ACH No. 251!); “Svecia” (H-ACH No. 312D photo!). = Hypocenomyce castaneocinerea (Räsänen) Timdal in Nordic J. Bot. 4: 97. 1984 ≡ Psora cladonioides var. castaneocinerea Räsänen, Lichenes Fenniae Exsiccati: No. 282. 1936 ≡ Lecidea cladonioides var. castaneocinerea (Räsänen) Zahlbr., Cat. Lich. Univ. 10: 346. 1939 – Lectotype (designated here): Finland, Karelia borealis, Pielisjärvi, Kitsinvaara, Ylinen Pitkäjärvi, ad truncum erectum carbonatum Pini silvestris in silva aprica deserta, July 1936, M. Laurila s.n. = Räsänen, Lichenes Fenniae Exsiccati: No. 282 (O No. L-895!; isotypes: BM!, UPS No. L-533306!). Note. – UPS-ACH 256 contains colensoic acid, 4-O-methylphysodic acid, ± norcolensoic acid and possibly trace of physodic acid (by TLC). Lecanoromycetidae families incertae sedis Sporastatiaceae Bendiksby & Timdal, fam. nov. [MB 804842] – Type: Sporastatia A. Massal. Diagnostic characters. – Thallus crustose, containing unicellular green algae, lacking cephalodia. Apothecia lecideine, black. Ascus narrowly clavate, polysporous, with a well-developed, deeply amyloid tholus without further amyloid structures. Ascospores hyaline, thin-walled, non-halonate, simple. Notes. – The family consists of two genera, Sporastatia and Toensbergia, and the description of the apothecia given above is made from the former as the latter is not known from fertile material. Sporastatia is currently placed in the Catillariaceae (Lumbsch & Huhndorf, 2010) because of its Catillaria-type ascus, but it differs from that family in its polyspory. Toensbergia Bendiksby & Timdal, gen. nov. [MB 804843] – Type: Toensbergia leucococca (R. Sant.) Bendiksby & Timdal. Diagnostic characters. – Thallus of minute, adnate, crenulate, grayish white areolae, lacking a hypothallus, containing alectorialic acid. Etymology. – The name honors Dr. Tor Tønsberg (born 1948), Bergen, in appreciation of his important work on sorediate, corticolous lichens. Notes. – The genus consists of a single, sterile species which was originally placed in Hypocenomyce, later in Pycnora, apparently due to its morphological, ecological and chemical resemblance with species of the H. xanthococca-group. Toensbergia leucococca (R. Sant.) Bendiksby & Timdal, comb. nov. [MB 804845] ≡ Hypocenomyce leucococca R. Sant. in Thunbergia 2: 3. 1986 ≡ Pycnora leucococca (R. Sant.) R. Sant. in Santesson & al., Lichen-forming Lichenicol. Fungi Fennoscand.: 275. 2004 – Holotype: Sweden, Härjedalen, Tännäs par., ca. 1 km E of Ramundbergets Fjällgård, 63°42′ N, 12°25′ E, alt. ca. 750 m, on the trunk of a birch in the subalpine birch forest, August 1977, R. Santesson 27901 = Moberg, Lichenes Selecti Exsiccati Upsaliensis No. 6 (UPS No. L-86993!; isotype: O No. L-328!). Ostropomycetidae Reeb, Lutzoni & Cl. Roux in Molec. Phylogen. Evol. 32: 1055. 2004. Baeomycetales Lumbsch, Huhndorf & Lutzoni in Mycol. Res. 111: 529. 2007. Trapeliaceae Hertel in Vorträge Gesamtgeb. Bot., n.s., 4: 181. 1970 – Type: Trapelia M. Choisy. Xylographa (Fr.) Fr., Fl. Scan.: 344. 1836 ≡ Stictis subg. Xylographa Fr., Syst. Mycol. 2: 197. 1822 – Type: Xylographa parallela (Ach.) Fr. Version of Record (identical to print version). 951 Bendiksby & Timdal • Polyphyletic Hypocenomyce Xylographa isidiosa (Elix) Bendiksby & Timdal, comb. nov. [MB 804846] ≡ Hypocenomyce isidiosa Elix in Mycotaxon 94: 219. 2006 – Holotype: Australia, Western Australia, Avon district, Charles Gardner Flora Reserve, central track, 20 km SW of Tammin along old York Road, 31°47′24″ S, 117°28′07″ E, alt. 305 m, on dead, charred wood in Eucalyptus woodland with Casuarina and Acacia in shallow gully, 22 April 2004, J.A. Elix 31849 (PERTH n.v.; isotype: CANB No. 737037!). Umbilicariomycetidae Miądl. & al. ex Bendiksby, Hestmark & Timdal, subcl. nov. [MB 805269] Description. – Thallus containing green algae, lacking cephalodia, crustose, squamulose, peltate, or umbilicatefoliose. Apothecia lecideine or lecanorine. Ascus rhombic to clavate, usually covered by an amyloid cap, usually with an amyloid inner layer near the ascus apex (± Fuscidea-type) or with a small, amyloid tholus, mono- to octosporous. Note. – Miądlikowska & al. (2006) published the name as a nomen nudum. Umbilicariales J.C. Wei & Q.M. Zhou in Mycosystema 26: 44. 2007. Ophioparmaceae R.W. Rogers & Hafellner in Lichenologist 20: 172. 1988 – Type: Ophioparma Norman. Hypocenomyce M. Choisy in Bull. Mens. Soc. Linn. Lyon 20: 133. 1951 – Type: H. scalaris (Ach.) M. Choisy. Included species. – Hypocenomyce australis Timdal, H. scalaris (Ach.) M. Choisy, H. tinderryensis Elix. Umbilicariaceae Chevall., Fl. Gen. Env. Paris 1: 640. 1826 – Type: Umbilicaria Hoffm. Fulgidea Bendiksby & Timdal, gen. nov. [MB 804847] – Type: Fulgidea oligospora (Timdal) Bendiksby & Timdal. Diagnostic characters. – Thallus squamulose, adnate or ascending and geotropically oriented, grayish green to dark brown, dull to shiny, epruinose, without hypothallus. Apothecia black, plane, persistently marginate, egyrose, epruinose; exciple composed of conglutinated, rather thin-walled hyphae with ellipsoid to shortly cylindrical lumina, inner part and rim blackish brown, the pigment partly dissolving in K with a brown effusion, N−, lacking crystals; epihymenium brown, N−, containing amorphous substances dissolving in K with a brown effusion; ascus narrowly rhombic, with an apical amyloid cap and a small, amyloid tholus containing a non-amyloid central plug. Pycnidium wall brown, N−; pycnoconidia bacilliform, 7–10 × ca. 1 µm. Chemistry: alectorialic and thamnolic acids. Etymology. – The name refers to its preferred substrate, burnt wood (lat. fulgur: lightning), and to its morphological resemblance to Lecidea species. Notes. – The genus differs from Hypocenomyce mainly in the anatomy of the exciple which in Hypocenomyce is colorless in the inner part, green in the rim (K−, N+ violet), and 952 TAXON 62 (5) • October 2013: 940–956 composed of only partly conglutinated hyphae which are separated by crystals of lecanoric acid (C+ red). Furthermore, in Hypocenomyce the epihymenium and the pycnidium wall are green, N+ violet, and the epihymenium contains lecanoric acid and lacks amorphous substances. The pycnoconidia are generally longer in Hypocenomyce, i.e., bacilliform to filiform. Fulgidea differs from Pycnora mainly in the ascus, which in Pycnora is broadly clavate, lack an amyloid cap, have a well-developed, amyloid tholus with a parietal deeper amyloid area (fig. 3 in Timdal 1984a). Furthermore, in Pycnora the thallus is strictly crustose, the epihymenium is green, N+ violet, containing amorphous substances dissolving in K with a violet effusion, the pycnidium wall is green, N+ violet, and the pycnoconidia shorter (subglobose to shortly bacilliform). Elixia differs from Fulgidea in forming a crustose or endoxylic thallus, star-shaped to lirelloid apothecia, capitate paraphyses with a sharply delimited pigment zone in the top of the apical cell, and in lacking secondary compounds. See also Xylopsora, below. Fulgidea oligospora (Timdal) Bendiksby & Timdal, comb. nov. [MB 804848] ≡ Hypocenomyce oligospora Timdal in Mycotaxon 77: 446. 2001 – Holotype: U.S.A., Arizona, Gila Co., Little Diamond Rim above Beaver Valley, 34°20′30″ N, 111°18′30″ W, alt. 1840 m, piñon-juniper woodland, on burned Juniperus wood, March 1999, T.H. Nash 42735a = Nash, Lichenes Exsiccati Distributed by Arizona State University No. 311 (O No. L-767!). Fulgidea sierrae (Timdal) Bendiksby & Timdal, comb. nov. [MB 804849] ≡ Hypocenomyce sierrae Timdal in Mycotaxon 77: 449. 2001 – Holotype: U.S.A., California, Los Angeles Co., San Gabriel Mts, along State Hwy 2, 0.3 mi NE (road) of Newcomb Ranch, 34°20.3′ N, 117°59.6′ W, alt. 1650 m, on trunk of Libocedrus decurrens, on lower, partly charred parts, March 1998, E. Timdal SON1251 (O No. L-60059!). Xylopsora Bendiksby & Timdal, gen. nov. [MB 804850] – Type: Xylopsora friesii (Ach.) Bendiksby & Timdal. Diagnostic characters. – Thallus squamulose, adnate or irregularly bullate, grayish green to dark brown, dull to shiny, epruinose, without hypothallus. Apothecia black, plane, persistently marginate, often gyrose, epruinose; exciple composed of conglutinated, rather thin-walled hyphae with ellipsoid to shortly cylindrical lumina, inner part and rim blackish brown, the pigment partly dissolving in K with a brown effusion, N−, lacking crystals; epihymenium brown, N−, containing amorphous substances dissolving in K with a brown effusion; ascus narrowly rhombic, with an apical amyloid cap and a small, amyloid tholus containing a non-amyloid central plug. Pycnidium wall brown, N−; pycnoconidia narrowly ellipsoid to shortly bacilliform, 2.5–5 × ca. 1 µm. Chemistry: friesiic acid (major; also confriesiic acid as minor or trace, according to Elix, 2006). Etymology. – The name refers to its preferred substrate, wood (gr. xylos), and its previous inclusion in Lecidea sect. Psora. Version of Record (identical to print version). Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 Notes. – The genus is morphologically and anatomically very similar to Fulgidea, and differs mainly in two characters: the size of the pycnoconidia (2.5–5 vs. 7–10 µm long) and the secondary chemistry friesiic acid (depsido-depsone) vs. alectorialic acid (benzyl ester) and thamnolic acid (β-orcinol metadepside). Xylopsora differs from Elixia, Hypocenomyce, and Pycnora in the same characters as listed under Fulgidea, above. Xylopsora caradocensis (Nyl.) Bendiksby & Timdal, comb. nov. [MB 804851] ≡ Lecidea caradocensis Leight. ex Nyl. in Actes Soc. Linn. Bordeaux 21: 383. 1857 ≡ Psora caradocensis (Leight. ex Nyl.) Mudd, Man. Brit. Lich.: 169. 1861 ≡ Toninia caradocensis (Leight. ex Nyl.) J. Lahm in Jahres-Ber. Westfäl. Prov.-Vereins Wiss. 11: 125. 1884 ≡ Bilimbia caradocensis (Leight. ex Nyl.) A.L. Sm. in Crombie & Smith, Monogr. Lich. Britain 2: 133. 1911 ≡ Hypocenomyce caradocensis (Nyl.) P. James & Gotth. Schneid. in Lichenologist 12: 107. 1980 – Lectotype (designated by Timdal, 1992): U.K., Wales, Shropshire, Caer Caradoc, W. Leighton s.n. = Leighton, Lichenes Britannici Exsiccati No. 160 (BM!; isotypes: O No. L-450!; UPS!). Xylopsora friesii (Ach.) Bendiksby & Timdal, comb. nov. [MB 804852] ≡ Lecidea friesii Ach. in Liljeblad, Utkast Sv. Fl., ed. 3: 610. 1816 ≡ Psora friesii (Ach.) Hellb. in Kongl. Svenska Vetensk. Acad. Handl., nov. ser., 9 (no. 11): 61. 1870 ≡ Biatora friesii (Ach.) Tuck., Syn. N. Amer. Lich. 2: 15. 1888 ≡ Psora ostreata f. friesii (Ach.) Boistel, Nouv. Fl. Lich. 2: 94. 1902 ≡ Hypocenomyce friesii (Ach.) P. James & Gotth. Schneid. in Biblioth. Lichenol. 13: 84. 1980 – Lectotype (designated here): “Lecidea friesiana. Suecia” (H-ACH No. 436A photo!). ACKNOWLEDGEMENTS We acknowledge generous financial support (Project no. 70184216) from the Norwegian Taxonomy Initiative (Norske Artsprosjektet) administered by The Norwegian Biodiversity Information Centre (Artsdatabanken). Thanks are also due to the curators of ASU, CANB, and S for the loan of specimens; to UPS for access to type material during our visit; to H for preparing high-resolution photographs of type specimens in the Acharius herbarium; to John A. Elix for providing a specimen of H. isidiosa, to Geir Hestmark, Jolanta Miądlikowska and Martin Westberg for discussions on the Umbilicariomycetidae and “Candelariomycetidae”; to Siri Rui for assistance in the lab, and to Toby Spribille and two anonymous reviewers for helpful feedback on an earlier version of this work. LITERATURE CITED Abassi Maaf, L. & Roux, C. 1984. Hypocenomyce stoechadiana nova likenspecio (Hypocenomyce stoechadiana espece nouvelle de lichen). Bull. Soc. Linn. Provence 36: 189–194. Bellemere, A. & Hafellner, J. 1982. L’ultrastructure des asques du genre Dactylospora (Discomycetes) et son interet taxonomique. Cryptog. Mycol. 3: 71–93. Bendiksby, M., Thorbek, L. & Halvorsen, R. 2011. Simple procedures for obtaining DNA sequences from old herbarium material. Series of dissertations submitted to the Faculty of Mathematics and Natural Sciences, University of Oslo 1070, 6: 1–17. Choisy, M. 1951. Catalogue des lichens de la region lyonnaise [Fasc. 7]. Bull. Mens. Soc. Linn. Lyon 20: 127–142. Choisy, M. 1953. Catalogue des lichens de la region lyonnaise [Fasc. 10]. Bull. Mens. Soc. Linn. Lyon 22: 177–192. Crespo, A. & Lumbsch, H.T. 2010. Cryptic species in lichen-forming fungi. IMA Fungus 1: 167–170. http://dx.doi.org/10.5598/imafungus.2010.01.02.09 Culberson, C.F. 1972. Improved conditions and new data for identification of lichen products by standardized thin-layer chromatographic method. J. Chromatogr. 72: 113–125. http://dx.doi.org/10.1016/0021-9673(72)80013-X Culberson, C.F. & Johnson, A. 1982. Substitution of methyl tert.-butyl ether for diethyl ether in the standardized thin-layer chromatographic method for lichen products. J. Chromatogr. 238: 483–487. http://dx.doi.org/10.1016/S0021-9673(00)81336-9 Ekman, S. & Blaalid R. 2011. The devil in the details: Interactions between the branch-length prior and likelihood model affect node support and branch lengths in the phylogeny of the Psoraceae. Syst. Biol. 60: 541–561. http://dx.doi.org/10.1093/sysbio/syr022 Ekman, S., Andersen, H.L. & Wedin, M. 2008. The limitations of ancestral state reconstruction and the evolution of the ascus in the Lecanorales (Lichenized Ascomycota). Syst. Biol. 57: 141–156. http://dx.doi.org/10.1080/10635150801910451 Elix, J.A. 2006 [“2005”]. New species of sterile crustose lichens from Australia. Mycotaxon 94: 219–224. Elix, J.A. 2007. Further new crustose lichens (Ascomycota) from Australia. Australas. Lichenol. 61: 21–25. Elix, J.A. 2009. Ophioparmaceae. Pp. 32–36 in: McCarthy, P.M. (ed.), Flora of Australia, vol. 57. Lichens, 5. Canberra and Melbourne: ABRS and CSIRO Publishing. Eriksson, O.E. & Winka, K. 1997. Supraordinal taxa of Ascomycota. Myconet 1: 1–16. Goloboff, P.A., Farris, J.S. & Nixon, K.C. 2008. TNT: A free program for phylogenetic analysis. Cladistics 24: 774–786. http://dx.doi.org/10.1111/j.1096-0031.2008.00217.x Grube, M. 2002. A note on Pachyascus lapponicus, an enigmatic lichen from northern Sweden. Graphis Scripta 13: 17–21. Hafellner, J. 1993. Die Gattung Pyrrhospora in Europa: Eine erste Übersicht mit einem Bestimmungsschlüssel der Arten nebst Bemerkungen zu einigen aussereuropäischen Taxa (lichenisierte Ascomycotina, Lecanorales). Herzogia 9: 725–747. Hafellner, J. & Casares-Porcel, M. 1992. Untersuchungen an den Typusarten der lichenisierten Ascomycetengattungen Acarospora und Biatorella und die daraus entstehenden Konsequenzen. Nova Hedwigia 55: 309–323. Hafellner, J. & Türk, R. 2001. Die lichenisierten Pilze Österreichs – Eine Checkliste der bisher nachgewiesenen Arten mit verbreitungsangaben. Stapfia 76: 1–167. Hall, T.A. 1999. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41: 95–98. Hawksworth, D.L., James, P.W. & Coppins, B.J. 1980. Checklist of British lichen-forming, lichenicolous and allied fungi. Lichenologist 12: 1–115. http://dx.doi.org/10.1017/S0024282980000035 Hibbett, D.S., Binder, M., Bischoff, J.F., Blackwell, M., Cannon, P.F., Eriksson, O.E., Huhndorf, S., James, T., Kirk, P.M., Luecking, R., Lumbsch, H.T., Lutzoni, F., Matheny, P.B., McLaughlin, D.J., Powell, M.J., Redhead, S., Schoch, C.L., Spatafora, J.W., Stalpers, J.A., Vilgalys, R., Aime, M.C., Aptroot, A., Bauer, R., Begerow, D., Benny, G.L., Castlebury, L.A., Crous, P.W., Dai, Y.-C., Gams, W., Geiser, D.M., Griffith, G.W., Gueidan, C., Hawksworth, D.L., Hestmark, G., Hosaka, K., Humber, R.A., Hyde, K.D., Ironside, J.E., Koljalg, U., Kurtzman, C.P., Larsson, Version of Record (identical to print version). 953 Bendiksby & Timdal • Polyphyletic Hypocenomyce K.-H., Lichtwardt, R., Longcore, J., Miadlikowska, J., Miller, A., Moncalvo, J.-M., Mozley-Standridge, S., Oberwinkler, F., Parmasto, E., Reeb, V., Rogers, J.D., Roux, C., Ryvarden, L., Sampaio, J.P., Schuessler, A., Sugiyama, J., Thorn, R.G., Tibell, L., Untereiner, W.A., Walker, C. Wang, Z., Weir, A., Weiss, M., White, M.M., Winka, K., Yao, Y.-J. & Zhang, N. 2007. A higher-level phylogenetic classification of the fungi. Mycol. Res. 111: 509–547. http://dx.doi.org/10.1016/j.mycres.2007.03.004 Hodkinson, B.P. 2012. An evolving phylogenetically based taxonomy of lichens and allied fungi. Opusc. Philolichenum 11: 4–10. Hofstetter, V., Miądlikowska, J., Kauff, F. & Lutzoni, F. 2007. Phylogenetic comparison of protein-coding versus ribosomal RNA-coding sequence data: A case study of the Lecanoromycetes (Ascomycota). Molec. Phylogen. Evol. 44: 412–426. http://dx.doi.org/10.1016/j.ympev.2006.10.016 Huelsenbeck, J.P. & Ronquist, F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. http://dx.doi.org/10.1093/bioinformatics/17.8.754 James, T. Y., Kauff, F., Schoch, C. L., Matheny, P. B., Hofstetter, V., Cox, C. J., Celio, G., Gueidan, C., Fraker, E., Miadlikowska, J., Lumbsch, H.T., Rauhut, A., Reeb, V., Arnold, A.E., Amtoft, A., Stajich, J.E., Hosaka, K., Sung, G.H., Johnson, D., O’Rourke, B., Crockett, M., Binder, M., Curtis, J.M., Slot, J.C., Wang, Z., Wilson, A.W., Schußler, A., Longcore, J.E., O’Donnell, K., Mozley-Standridge, S., Porter, D., Letcher, P.M., Powell, M.J., Taylor, J.W., White, M.M., Griffith, G.W., Davies, D.R., Humber, R.A., Morton, J.B., Sugiyama, J., Rossman, A.Y., Rogers, J.D., Pfister, D.H., Hewitt, D., Hansen, K., Hambleton, S., Shoemaker, R.A., Kohlmeyer, J., Volkmann-Kohlmeyer, B., Spotts, R.A., Serdani, M., Crous, P.W., Hughes, K.W., Matsuura, K., Langer, E., Langer, G., Untereiner, W.A., Lucking, R., Budel, B., Geiser, D.M., Aptroot, A., Diederich, P., Schmitt, I., Schultz, M., Yahr, R., Hibbett, D.S., Lutzoni, F., McLaughlin, D.J., Spatafora, J.W. & Vilgalys, R. 2006. Reconstructing the early evolution of fungi using a six-gene phylogeny. Nature 443: 818–822. http://dx.doi.org/10.1038/nature05110 Jobb, G., Haeseler, A. von & Strimmer, K. 2004. TREEFINDER: A powerful graphical analysis environment for molecular phylogenetics. B. M. C. Evol. Biol. 4: 18. http://dx.doi.org/10.1186/1471-2148-4-18 Leavitt, S.D., Esslinger, T.L., Divakar, P.K. & Lumbsch, H.T. 2012. Miocene divergence, phenotypically cryptic lineages, and contrasting distribution patterns in common lichen-forming fungi (Ascomycota: Parmeliaceae). Biol. J. Linn. Soc. 107: 920–937. http://dx.doi.org/10.1111/j.1095-8312.2012.01978.x Lumbsch, H.T. & Huhndorf, S.M. 2010. Myconet Volume 14. Part One. Outline of Ascomycota—2009. Part Two. Notes on Ascomycete Systematics. Nos. 4751–5113. Fieldiana, Life Earth Sci. 1: 1–64. http://dx.doi.org/10.3158/1557.1 Lumbsch, H.T. & Leavitt, S.D. 2011. Goodbye morphology? A paradigm shift in the delimitation of species in lichenized fungi. Fungal Diversity 50: 59–72. http://dx.doi.org/10.1007/s13225-011-0123-z Lumbsch, H.T., Schmitt, I., Lücking, R., Wiklund, E. & Wedin, M. 2007. The phylogenetic placement of Ostropales within Lecanoromycetes (Ascomycota) revisited Mycol. Res. 111: 508–508. http://dx.doi.org/10.1016/j.mycres.2007.01.006 Lutzoni, F., Kauff, F., Cox, C.J., McLaughlin, D., Celio, G., Dentinger, B., Padamsee, M., Hibbett, D., James, T.Y., Baloch, E., Grube, M., Reeb, V., Hofstetter, V., Schoch, C., Arnold, A.E., Miadlikowska, J., Spatafora, J., Johnson, D., Hambleton, S., Crockett, M., Shoemaker, R., Sung, G.H., Lucking, R., Lumbsch, T., O’Donnell, K., Binder, M., Diederich, P., Ertz, D., Gueidan, C., Hansen, K., Harris, R.C., Hosaka, K., Lim, Y.W., Matheny, B., Nishida, H., Pfister, D., Rogers, J., Rossman, A., Schmitt, I., Sipman, H., Stone, J., Sugiyama, J., Yahr, R. & Vilgalys, R. 2004. Assembling the fungal tree of life: Progress, 954 TAXON 62 (5) • October 2013: 940–956 classification and evolution of subcellular traits. Amer. J. Bot. 91: 1446–1480. http://dx.doi.org/10.3732/ajb.91.10.1446 Menlove, J.E. 1974. Thin-layer chromatography for the identification of lichen substances. Bull. Brit. Lichen Soc. 34: 3–5. Miądlikowska, J., Kauff, F., Hofstetter, V., Fraker, E., Grube, M., Hafellner, J., Reeb, V., Hodkinson, B.P., Kukwa, M., Lücking, R., Hestmark, G., Otalora, M.G., Rauhut, A., Büdel, B., Scheidegger, C., Timdal, E., Stenroos, S., Brodo, I.M., Perlmutter, G.B., Ertz, D., Diederich, P., Lendemer, J.C., May, P.F., Schoch, C., Arnold, A.E., Gueidan, C., Tripp, E., Yahr, R., Robertson, C. & Lutzoni, F. 2006. New insights into classification and evolution of the Lecanoromycetes (Pezizomycotina, Ascomycota) from phylogenetic analyses of three ribosomal RNAand two protein-coding genes. Mycologia 98: 1088–1103. http://dx.doi.org/10.3852/mycologia.98.6.1088 Moberg, R. 1986. Lichenes Selecti Exsiccati Upsaliensis, fasc. 1 (Nos 1–25). Thunbergia 2: 1–10 Poelt, J. & Vĕzda, A. 1981. Bestimmungsschlüssel europäischer Flechten. Ergänzungsheft II. Biblioth. Lichenol. 16: 1–390. Printzen, C. 1995. Die Flechtengattung Biatora in Europa. Biblioth. Lichenol. 60: 1–275. Rivas Plata, E. & Lumbsch, H.T. 2011. Parallel evolution and phenotypic disparity in lichenized fungi: A case study in the lichenforming fungal family Graphidaceae (Ascomycota: Lecanoromycetes: Ostropales). Molec. Phylogen. Evol. 61: 45–63. http://dx.doi.org/10.1016/j.ympev.2011.04.025 Rivas Plata, E., Lücking, R. & Lumbsch, H.T. 2012. Molecular phylogeny and systematics of the Ocellularia clade (Ascomycota: Ostropales: Graphidaceae). Taxon 61: 1161–1179. Ronquist, F. & Huelsenbeck, J.P. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. http://dx.doi.org/10.1093/bioinformatics/btg180 Roux, C. & Clerc, P. 1991. Présence du genre Waynea Moberg (Lichenes) en Europe. Bull. Soc. Linn. Provence 42: 123–130. Schneider, G. 1980 [“1979”]. Die Flechtengattung Psora sensu Zahlbruckner. Biblioth. Lichenol. 13: 1–291. Schoch, C.l., Sung, G.-H., López-Giráldez, F., Townsend, J.P., Miądlikowska, J., Hofstetter, V., Robbertse, B., Matheny, B., Kauff, F., Wang, Z., Gueidan, C., Andrie, R.M., Trippe, K., Ciufetti, L.M., Wynns, A., Fraker, E., Hodkinson, B.P., Bonito, G., Groenewald, J.Z., Arzanlou, M., De Hoog, G.S., Crous, P.W., Hewitt, D., Pfister, D., Peterson, K., Gryzenhout, M., Wingfield, M.J., Aptroot, A., Suh, S.-O., Blackwell, M., Hillis, D.M., Griffith, G.W., Castlebury, L.A., Rossman, A., Lumbsch, H.T., Lücking, R., Büdel, B., Rauhut, A., Diederich, P., Ertz, D., Geiser, D.M., Hosaka, K., Inderbitzin, P., Kohlmeyer, J., Volkmann-Kohlmeyer, B., Mostert, L., O‘Donnell, K., Sipman, H., Rogers, J.D., Shoemaker, R., Sugiyama, J., Summerbell, R.C., Untereiner, W., Johnston, P.R., Stenroos, S., Zuccaro, A., Dyer, P.S., Crittenden, P.D., Cole, M.S., Hansen, K., Trappe, J.M., Yahr, R., Lutzoni, F. & Sapatafora, J.W. 2009. The Asco mycota Tree of Life: A phylum-wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits. Syst. Biol. 58: 224–239. http://dx.doi.org/10.1093/sysbio/syp020 Schmull, M., Miądlikowska, J., Pelzer, M., Stocker-Woergoetter, E., Hofstetter, V., Fraker, E., Hodkinson, B.P., Reeb, V., Kukwa, M., Lumbsch, H.T., Kauff, F. & Lutzoni, F. 2011. Phylogenetic affiliations of members of the heterogeneous lichen-forming fungi of the genus Lecidea sensu Zahlbruckner (Lecanoromycetes, Ascomycota). Mycologia 103: 983–1003. http://dx.doi.org/10.3852/10-234 Spribille, T. & Lumbsch, H.T. 2010. A new species of Elixia (Umbilicariales) from Greece. Lichenologist 42: 365–371. http://dx.doi.org/10.1017/S0024282910000058 Stamatakis, A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690. http://dx.doi.org/10.1093/bioinformatics/btl446 Version of Record (identical to print version). Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 Tibell, L. 1984. A reappraisal of the taxonomy of Caliciales. Beih. Nova Hedwigia 79: 597–713. Timdal, E. 1984a. The genus Hypocenomyce (Lecanorales, Lecideaceae), with special emphasis on Norwegian and Swedish species. Nordic J. Bot. 4: 83–108. http://dx.doi.org/10.1111/j.1756-1051.1984.tb01979.x Timdal, E. 1984b. The delimitation of Psora (Lecideaceae) and related genera, with notes on some species. Nordic J. Bot. 4: 525–540. http://dx.doi.org/10.1111/j.1756-1051.1984.tb02059.x Timdal, E. 1992. A monograph of the genus Toninia (Lecideaceae, Ascomycetes). Opera Bot. 110: 1–137. Timdal, E. 2001. Hypocenomyce oligospora and H. sierrae, two new lichen species. Mycotaxon 77: 445–453. Timdal, E. 2002. Hypocenomyce. Pp. 223–228 in: Nash, T.H., III, Ryan, B.D., Gries, C. & Bungartz, F. (eds.), Lichen flora of the Greater Sonoran Desert Region, vol. 1. Tempe: Lichens Unlimited, Arizona State University. Wedin, M., Wiklund, E., Crewe, A., Döring, H., Ekman, S., Nyberg, Å., Schmitt, I. & Lumbsch, H.T. 2005. Phylogenetic relationships of Lecanoromycetes (Ascomycota) as revealed by analyses of mtSSU and nLSU rDNA sequence data. Mycol. Res. 109: 159–172. http://dx.doi.org/10.1017/S0953756204002102 Westberg, M., Arup, U. & Kärnefelt, I. 2007. Phylogenetic studies in the Candelariaceae (lichenized Ascomycota) based on nuclear ITS DNA sequence data. Mycol. Res. 111: 1277–1284. http://dx.doi.org/10.1016/j.mycres.2007.08.007 White, T.J., Bruns, T., Lee, S. & Taylor, J.W. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315–322 in: Innis, M.A., Gelfand, D.H., Sninsky, J.J. & White, T.J. (eds.), PCR protocols: A guide to methods and applications. New York: Academic Press. Zahlbruckner, A. 1925. Catalogus lichenum universalis, Band 3. Leipzig: Gebrüder Borntraeger. Zoller, S., Scheidegger, C. & Sperisen, C. 1999. PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming ascomycetes. Lichenologist 31: 511–516. http://dx.doi.org/10.1006/lich.1999.0220 http://dx.doi.org/10.1017/S0024282999000663 Appendix 1. Taxa and GenBank accession numbers for all samples included in this study; voucher information is given for newly generated sequences. An asterisk after the accession number indicates sequences reported here for the first time. Taxon, voucher, accession number of nrITS, nrLSU, mtSSU. — Signs/symbols used: – missing data; * newly generated sequence; † only 5.8S and ITS2; ♦ sequences less than 200 bp that are provided below Appendix 1 because GenBank does not accept sequences shorter than 200 bp. Acarospora peliscypha Th. Fr., DQ374132, –, DQ374108. Agyrium rufum (Pers.) Fr., –, EF581826, EF581823. Ainoa mooreana (Carroll) Lumbsch & I. Schmitt, –, AY212828, AY212850. Arctomia delicatula Th. Fr., –, AY853355, AY853307. Aspicilia cinerea (L.) Körb., HQ650637†, DQ986779, DQ986890. Bacidia rubella (Hoffm.) A. Massal., AF282087†, –, AY567723. Baeomyces rufus (Huds.) Rebent., AF448458†, DQ871008, DQ871016. Biatora vernalis (L.) Fr., Norway, J.T. Klepsland JK09-L616 (O L-165159), KF360369*†, KF360446*, KF360418*. Boreoplaca ultrafrigida Timdal, HM161512, AY853360, AY853312. Bryoria capillaris (Ach.) Brodo & D. Hawksw., AF058032†, DQ923655, DQ923626. Calopadia sp., –, EU601752, EU601739. Candelaria concolor (Dicks.) Stein, GU929922, DQ986791, DQ986806. Candelariella aurella (Hoffm.) Zahlbr., EF535162, AY853361, AY853313. Candelariella coralliza (Nyl.) H. Magn., AF182074, AY853362, AY853314. Candelariella reflexa (Nyl.) Lettau, EF535190, DQ912331, DQ912272. Candelariella terrigena Räsänen, HQ650602, DQ986745, –. Candelariella vitellina (Hoffm.) Müll. Arg., AJ640085, AY853363, AY853315. Catillaria chalybeia (Borrer) A. Massal., Norway, R. Haugan 7947 (O L-155291), KF360370*†, KF360447*, –. Catolechia wahlenbergii (Ach.) Körb., AF250792, DQ986794, DQ986811. Cladia retipora (Labill.) Nyl., GQ500918†, AY340540, AY340487. Cladonia rangiferina (L.) F.H. Wigg, EU266113†, AY300832, AY300881. Coccotrema cucurbitula (Mont.) Müll. Arg., AF329162†, AF274092, AF329161. Crocynia pyxinoides Nyl., AF517920†, AY584653, AY584615. Diploschistes scruposus (Schreb.) Norman, HQ650716†, AF279389, AY584692. Elixia cretica T. Sprib. & Lumbsch 1, Australia, New South Wales, Tinderry Range, 10 km E of Michelago, H. Streimann & J.A. Curnow 50968 p.p. (CANB-9304299 p.p.), KF360371*, KF360448*, –. 2, Mexico, Chihuahua, along route 16 ca. 20 km W of Basaseachic, E. Timdal SON78/03 (O L-15969), KF360372*, KF360449*, KF360419*. 3, –, –, GQ892058. Elixia flexella (Ach.) Lumbsch 1, Austria, J. Halda, S. Palica & J. Steinova 12407 (O L-157191), KF360373*, KF360450*, KF360420*. 2, –, AY853368, AY853320. 3, –, AY300837, AY300887. Elixia sp. T. Sprib. & Lumbsch 1, U.S.A., Arizona, Gila Co., McFadden Peak, 15 mi S of Young, T.H. Nash III 11177 (ASU), KF360374*, KF360451*, –. 2, U.S.A., Arizona, Cochise Co., Chiricahua National Monument, along the Loop Trail, T.H. Nash III 41750 (ASU), KF360375*, KF360452*, –. Evernia prunastri (L.) Ach., HQ650611†, AF107562, AF351162. Fuscidea mollis (Wahlenb.) V. Wirth & Vezda, –, AY853369, AY853321. Geoglossum nigritum (Fr.) Cooke, DQ491490, AY544650, AY544740. Graphis scripta (L.) Ach., AF229195†, AY853370, AY853322. Gregorella humida (Kullh.) Lumbsch, AF429263†, AY853378, –. Gypsoplaca macrophylla (Zahlbr.) Timdal, –, DQ899298, –. Haematomma ochroleucum (Neck.) J.R. Laundon, EU075536†, AY756350, AY756367. Heterodea muelleri (Hampe) Nyl., GQ500906†, AY340545, AY340494. Hymenelia lacustris (With.) M. Choisy, –, AY853371, AY853323. Hypocenomyce anthracophila (Nyl.) P. James & Gotth. Schneid. 1, Norway, B.P. Løfall & A. Ognedal L10657 (O L-129736), KF360376*, KF360453*, KF360421*. 2, Norway, J.T. Klepsland JK08-L282 (O L-158453), KF360377*, KF360454*, KF360422*. 3, Norway, E. Timdal 11024 (O L-158536), KF360378*, KF360455*, KF360423*. 4, Norway, E. Timdal 11027 (O L-158539), KF360379*, KF360456*, KF360424*. Hypocenomyce australis Timdal 1, Australia, J.A. Elix 19801 (O L-144372), KF360380*†, –, –. 2, Australia, H. Krog Au14/2 (O L-144373), ♦*, –, –. 3, Australia, W.A. Weber & D. McVean s.n., 1967–10–11 (O L-201, isotype), KF360381*†, –, –. 4, Australia, G. Thor 6047a (S), KF360382*, –, –. Hypocenomyce caradocensis (Nyl.) P. James & Gotth. Schneid. 1, Norway, E. Timdal 2410 (O L-32967), KF360383*†, –, –. 2, Sweden, G. Westling s.n., 1992–04–05 (S-L-53582), KF360384*†, –, –. 3, Sweden, G. Odelvik 599 (S-L-29227), KF360385*, –, KF360425*. Hypocenomyce castaneocinerea (Räsänen) Timdal 1, Norway, R. Haugan 9677 (O L-166561), KF360386*, KF360457*, KF360426*. 2, Norway, E. Timdal 11028 (O L-158540), KF360387*, KF360458*, KF360427*. Hypocenomyce foveata Timdal, Australia, G. Thor 6047b (S), ♦*, –, –. Hypocenomyce friesii (Ach.) P. James & Gotth. Schneid. 1, Norway, E. Timdal 11029 (O L-158541), KF360388*, KF360459*, KF360428*. 2, Norway, A. Breili 3615 (O L-167185), KF360389*, KF360460*, KF360429*. 3, –, AY853372, AY853324. 4, Norway, E. Timdal 1055 (O L-56480), KF360390*†, –, –. Hypocenomyce isidiosa Elix 1, Australia, J.A. Elix 31849 (CANB-737037.1, isotype), KF360391*, KF360461*, KF360430*. 2, Australia, J.A. Elix 39837 (O L-171593), KF360392*, KF360462*, KF360431*. Hypocenomyce leucococca R. Sant. 1, Norway, E. Timdal 12232 (O L-170732), KF360393*, KF360463*, KF360432*. 2, Norway, E. Timdal 12328 (O L-170828), KF360394*, KF360464*, KF360433*. Hypocenomyce oligospora Timdal 1, U.S.A., T.H. Nash III 42735a (O L-767, holotype), KF360395*, KF360465*, –. 2, U.S.A., S. Rui & E. Timdal US215/01 (O L-59862), KF360396*, KF360466*, KF360434*. 3, U.S.A., S. Rui & E. Timdal US272/01 (O L-59992), KF360397*, KF360467*, KF360435*. 4, Russia, R. Haugan & E. Timdal YAK04/05 (O L-18713), KF360398*, KF360468*, –. Hypocenomyce praestabilis (Nyl.) Timdal 1, U.S.A., E. Timdal SON70/13 (O L-15871), KF360399*, –, –. 2, Sweden, E. Timdal 2860 (O L-144277), KF360400*, KF360469*, –. Hypocenomyce scalaris (Ach.) M. Choisy 1, Norway, E. Timdal 11022 (O L-158534), KF360401*, KF360470*, KF360436*. 2, DQ782852, DQ782914, DQ912274. 3, HQ650632, DQ986748, DQ986861. 4, –, AY853373, AY853325. 5, –, AY853374, AY853326. Hypocenomyce sierrae Timdal 1, U.S.A., S. Rui & E. Timdal US249/01 (O L-59964), KF360402*, KF360471*, KF360437*. 2, U.S.A., E. Timdal SON125/01 (O L-60059, holotype), KF360403*, –, –. Hypocenomyce sorophora (Vain.) P. James & Poelt 1, Norway, M. Bendiksby & J. Klepsland MB-L1 (O L-175410), KF360404*, –, KF360438*. 2, Norway, E. Timdal 2643 (O L-60179), KF360405*†, –, –. 3, Norway, E. Timdal 3343 (O L-28248), KF360406*, –, KF360439*. 4, Sweden, E. Timdal 2908 (O L-144310), ♦*†, –, –. 5, FJ959357, AY853387, AY853338. Hypocenomyce tinderryensis Elix 1, Version of Record (identical to print version). 955 Bendiksby & Timdal • Polyphyletic Hypocenomyce TAXON 62 (5) • October 2013: 940–956 Appendix 1. Continued. Australia, J.A. Elix 38733 (CANB-790800), KF360407*, –, KF360440*. 2, Australia, J.A. Elix 33386 (CANB-9801742.1), KF360408*†, –, –. 3, Australia, J.A. Elix 33387 (CANB-676257), KF360409*†, –, –. 4, Australia, H. Streimann & J.A. Curnow 50968 (CANB-9304299, holotype), KF360410*, –, –. 5, Australia, H. Streimann & J.A. Curnow 35001 (CANB-610213.1), ♦*†, –, –. Hypocenomyce xanthococca (Sommerf.) P. James & Gotth. Schneid. 1, Norway, R. Haugan 8090 (O L-160472), KF360411*, KF360472*, KF360441*. 2, Norway, E. Timdal 11646 (O L-163707), KF360412*, KF360473*, KF360442*. 3, AY853388, AY853388, AY853339. Lasallia pennsylvanica (Hoffm.) Llano, HM161513, AF356665, AY631278. Lasallia pustulata (L.) Mérat, HM161456, DQ883690, DQ986889. Lecanora carpinea (L.) Vain., AF070020†, DQ787363, DQ787364. Lecanora polytropa (Hoffm.) Rabenh., HQ650643†, DQ986792, DQ986807. Lecanora sulphurea (Hoffm.) Ach., AF070030†, –, EF105419. Lecidea atrobrunnea (Lam. & DC.) Schaer., EU259897, AY532993, GU074510. Lecidea tessellata Flörke, EU263926, AY532998, GU074491. Lecidella euphorea (Flörke) Hertel, HQ650596†, –, DQ986784. Lepraria lobificans Nyl., HQ650623, DQ986768, DQ986887. Lobothallia radiosa (Hoffm.) Hafellner, JF703124†, DQ780306, DQ780274. Lopadium disciforme (Flot.) Kullh., –, AY756355, AY756373. Loxospora ochrophaea (Tuck.) R.C. Harris, HQ650641†, DQ986750, DQ986900. Maronea constans (Nyl.) Hepp, –, AY640956, EF659771. Megalaria grossa (Nyl.) Hafellner, AF282074†, AY756356, AY762095. Meridianelia maccarthyana Kantvilas & Lumbsch, –, –, FJ763185. Metus conglomeratus (F. Wilson) D.J. Galloway & P. James, GQ500912†, AY340555, AY340510. Micarea adnata Coppins, AY756468†, AY756326, AY567751. Miltidea ceroplasta (C. Bab.) D.J. Galloway & Hafellner, –, HQ391558, HQ391557. Mycoblastus sanguinarius (L.) Norman, DQ782842†, DQ912333, DQ912276. Myelochroa aurulenta (Tuck.) Elix & Hale, –, DQ973025, DQ972972. Myriospora smaragdula (Wahlenb.) Nägeli, AY853354, AY853354, AY853306. Neophyllis melacarpa F. Wilson, –, AY340556, AY340511. Nephroma arcticum (L.) Torss., –, DQ973040, –. Ochrolechia parella (L.) A. Massal., AF332123†, AF274097, AF329173. Ophioparma handelii (Zahlbr.) Printzen & Rambold, China, W. Obermayer 5135 (O L-168529), KF360413*, –, –. Ophioparma lapponica (Räsänen) Hafellner & R.W. Rogers, Norway, E. Timdal 12353 (O L-170853), KF360414*, –, KF360443*. Ophioparma ventosa (L.) Norman 1, Norway, R. Haugan 7615 (O L-151477), KF360415*, KF360474*, KF360444*. 2, AY011013, AY853380, AY853331. Orceolina kerguelensis (Tuck.) Hertel, AY212814, AY212830, AF381561. Parmelina quercina (Willd.) Hale, AY611105†, AY607818, AY611164. Peltigera praetextata (Sommerf.) Zopf, –, AF286813, –. Pertusaria dactylina (Ach.) Nyl., DQ782843†, DQ782907, DQ912307. Pertusaria leioplaca DC., AF332125†, AY300852, AY300903. Pilophorus strumaticus Cromb., AF517931†, AY340560, AY340517. Placopsis sp. D.L. Galloway, ined., AY212826, AY212845, AY212867. Placynthiella uliginosa (Schrad.) Coppins & P. James, HQ650633, DQ986774, DQ986877. Pleopsidium flavum Körb., AY853385, AY853385, AY853336. Pleopsidium gobiense (H. Magn.) Hafellner, HQ650723, DQ883698, DQ991755. Porpidia macrocarpa (DC.) Hertel & A.J. Schwab, EU263923, AY532964, GU074512. Porpidia speirea (Ach.) Kremp., HQ650631, DQ986758, DQ986865. Protoblastenia rupestris (Scop.) J. Steiner, EF524318†, AY756358, –. Protothelenella sphinctrinoidella (Nyl.) H. Mayrhofer & Poelt, –, AY607735, AY607747. Psilolechia leprosa Coppins & Purvis, AY756496†, AY756333, AY567730. Psora decipiens (Hedw.) Hoffm., HQ650619†, DQ986760, –. Ptychographa xylographoides Nyl., –, –, AY212872. Pyrrhospora quernea (Dicks.) Körb., AF517930†, AY300858, AY567712. Ramalina complanata (Sw.) Ach., –, DQ973038, DQ972986. Rhizocarpon oederi (Weber) Körb., AF483612, DQ986804, DQ986788. Rhizoplaca chrysoleuca (Sm.) Zopf, AF159940†, DQ787353, DQ787354. Rimularia psephota (Tuck.) Hertel & Rambold, –, DQ871012, DQ871019. Sarcogyne privigna (Ach.) A. Massal., DQ374145, AY853392, DQ374124. Schaereria fuscocinerea (Nyl.) Clauzade & Cl. Roux, AF274090†, AY300860, AY300910. Scoliciosporum umbrinum (Ach.) Arnold, AY541277†, AY300861, AY300911. Solenopsora holophaea (Mont.) Samp., AM292708†, –, –. Sphaerophorus globosus (L.) DC., HQ650622†, DQ986767, DQ986866. Sporastatia polyspora (Nyl.) Grummann, –, AY640968, AY584724. Sporastatia testudinea (Ach.) A. Massal., –, AY640969, AY584725. Stereocaulon paschale (L.) Hoffm., HQ650690†, AY340568, AY584726. Teloschistes flavicans (Sw.) Norman, –, EU680955, –. Tephromela atra (Huds.) Hafellner, HQ650608†, DQ986766, DQ986879. Thamnolia vermicularis (Sw.) Schaer., EU714437†, –, AY853345. Thelotrema suecicum (H. Magn.) P. James, AJ508684†, AY300867, AY300917. Toninia sedifolia (Scop.) Timdal, HQ650689†, DQ973039, DQ972987. Trapelia placodioides Coppins & P. James, AF274081, AF274103, AF431962. Trapeliopsis granulosa (Hoffm.) Lumbsch, AF353569, AF274119, AF381567. Tremolecia atrata (Ach.) Hertel, –, AY853397, AY853397. Umbilicaria africana (Jatta) Krog & Swinscow, HM161482, HM161545, HM161572. Umbilicaria aprina Ach., HM161483, HM161514, HM161573. Umbilicaria crustulosa (Ach.) Lamy, HM161496, HM161590, HM161612. Umbilicaria proboscidea (L.) Schrad., FR799305, AY300870, AY300920. Umbilicaria spodochroa Hoffm., HM161481, DQ986773, DQ986815. Wawea fruticulosa Henssen & Kantvilas, –, DQ007347, DQ871023. Xanthoria parietina (L.) Beltr., –, AF356687, –. Xylographa opegraphella Rothr., Norway, E. Timdal 12066 (O L-170568), –, KF360475*, –. Xylographa parallela (Ach. : Fr.) Fr., Norway, E. Timdal 10892 (O L-152948), KF360416*, KF360476*, KF360445*. Xylographa trunciseda (Th. Fr.) Redinger, Norway, R. Haugan ål2804c2 (O L-131751), KF360417*, KF360477*, –. Xylographa soralifera Holien & Tønsberg, –, AY212849, AY212878. ♦ Sequences shorter than 200 bp: Hypocenomyce australis 2, Australia, H. Krog Au14/2 (O L-144373), ITS1 and 5.8S ribosomal RNA gene, partial AGGCCGAACCTCCCACCCTTTGTGTACCTTACCTTTGTTGCTTTGGCGGGCCCGTGGGGATCACCCACCGTCGGCTCCGGTTGACGCGTGCC CGCCAGA Hypocenomyce foveata, Australia, G. Thor 6047b (S), 5.8S ribosomal RNA gene and ITS2, partial sequences: CTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCAACCCTCAAGCGCAGCTTGGTGTTGGGCCTC CGCCCCCCTGGGCGTGCCCGAAAAGCAGTGGCGGTCCGGGATGACTCCAAGCGAAGTAGAATTTTTCCGCTTCCGGAGTTCGCCCCGTGGC CCGCCAGACAACCAC Hypocenomyce sorophora 4, Sweden, E. Timdal 2908 (O L-144310), 5.8S ribosomal RNA gene and ITS2, partial sequences: ACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCTCAGCTTGGTATTGGGCCTTCACCCCT CGCGGGTGTGCCTAAAAATCAGTGGCGGTGCCGCCTGGCTTCAAGCGTAGTAATTATTTCTCGCTCTGGAAGTCCGGGTGCGTTGCCTGCCAT CAACCCCC Hypocenomyce tinderryensis 5, Australia, H. Streimann & J.A. Curnow 35001 (CANB-610213.1), 5.8S ribosomal RNA gene and ITS2, partial sequences: GCACATTGCGCCCCTCGGTATTCCKAGGGGCATGCSTGTTCGAGCGTCATTACACCCCTCAAGCCCTGCTTGGTCTTGGGCCTCGTCCCCCGG GACGTGCCCGAAAGTCAGTGGNGGCCCGGTCCGACTTCAAGCGTAGTAAATACATCATTCCGCTTTGGAAGCCTCTGGGCCGGTC 956 Version of Record (identical to print version).