Two-Gene Phylogeny of Bright-Spored Myxomycetes (Slime Moulds, Superorder Lucisporidia) Anna Maria Fiore-Donno1,2*¤, Fionn Clissmann2, Marianne Meyer3, Martin Schnittler2, Thomas CavalierSmith1 1 Zoology Department, University of Oxford, Oxford, United Kingdom, 2 Institute of Botany and Landscape Ecology, University of Greifswald, Greifswald, Germany, 3 Le Bayet, Rognaix, France Abstract Myxomycetes, or plasmodial slime-moulds, are one of the largest groups in phylum Amoebozoa. Nonetheless, only ,10% are in the database for the small subunit (SSU) ribosomal RNA gene, the most widely used gene for phylogenetics and barcoding. Most sequences belong to dark-spored Myxomycetes (order Fuscisporida); the 318 species of superorder Lucisporidia (bright-spored) are represented by only eleven genuine sequences. To compensate for this, we provide 66 new sequences, 37 SSU rRNA and 29 elongation factor 1-alpha (EF-1a), for 82% of the genera of Lucisporidia. Phylogenetic analyses of single- and two-gene alignments produce congruent topologies and reveal both morphological characters that have been overemphasised and those that have been overlooked in past classifications. Both classical orders, Liceida and Trichiida, and several families and genera are para/polyphyletic; some previously unrecognised clades emerge. We discuss possible evolutionary pathways. Our study fills a gap in the phylogeny of Amoebozoa and provides an extensive SSU rRNA sequence reference database for environmental sampling and barcoding. We report a new group I intron insertion site for Myxomycetes in one Licea. Citation: Fiore-Donno AM, Clissmann F, Meyer M, Schnittler M, Cavalier-Smith T (2013) Two-Gene Phylogeny of Bright-Spored Myxomycetes (Slime Moulds, Superorder Lucisporidia). PLoS ONE 8(5): e62586. doi:10.1371/journal.pone.0062586 Editor: Simonetta Gribaldo, Institut Pasteur, France Received December 23, 2012; Accepted March 23, 2013; Published May 7, 2013 Copyright: ß 2013 Fiore-Donno et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by the Leverhulme Trust research grant R1008101 to the first and last authors and the Deutsche Forschungsgemeinschaft grant SCHN1080-2/1 to the first and fourth authors. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: afiore-donno6@infomaniak.ch ¤ Current address: Institute of Zoology, University of Cologne, Cologne, Germany (Liceida Jahn, 1928 and Trichiida Macbride, 1922), 22 genera and 318 species (http://eumycetozoa.com/data/index.php, updated 20.7.12) (Table 1). Readers unfamiliar with these taxa can find excellent illustrated descriptions [10,11,12] or consult the online searchable database of the eumycetozoan project at the University of Arkansas (http://slimemold.uark.edu/databaseframe.htm, last accessed: 19 Sep. 2012). We shall use only a few specialized terms, explained below. Differentiation of the plasmodium into a fruiting body (sporophore) forms three structures: peridium, capillitium, and spores. The peridium is the wall surrounding the fruiting body, and the capillitium is a system of threads interwoven throughout the spores (best seen in Fig. 1K). The sporophore is named according to its shape: most common are individual sporocarps or sporangia, stalked (Fig. 1 A, J, K, O) or sessile (Fig. 1 F, H, I, L, N). In the former, the ensemble of the spore mass, peridium and capillitium (the two latter facultative) is called the sporotheca, to differentiate the ‘‘fertile’’ part from the stalk. Large sporophores (.1 cm) are mostly a compound of multiple sporangia: if the sporangia are delimited, it is called a pseudoaethalium (Fig. 1 C, G), and an aethalium when it looks like a single mass (Fig. 1 B, D, E). Considerable taxonomic value has been placed on the capillitium: its presence/absence distinguishes the two classical orders of Lucisporidia (present in Trichiida; lacking in Liceida). Introduction Myxomycetes, or plasmodial slime-moulds, are exceptional in several respects. Most striking is their life cycle: a giant multinucleate amoeba (up to several dm2) is formed by fusion of two amoebae. This cycle is often sexual, culminating in the formation of mainly macroscopic fruiting bodies, of astonishing variety in shape and colour, that will ultimately release billions of spores - the life cycle is illustrated in many text books (see, among others, [1]). The evolutionary success of Myxomycetes is indicated by their numbering 941 species (listed in ‘‘An online nomenclatural information system of Eumycetozoa’’, http://eumycetozoa. com/data/index.php, updated 20.7.12), thus with arcellindid testate amoebae being one of the two largest groups within the phylum Amoebozoa. Myxomycetes are a firmly established clade within Amoebozoa, probably sisters to Dictyostelea, and more distantly related to Protostelida, Variosea, and perhaps Archamoebae, but relationships amongst these five taxa remain uncertain [2–7]. Myxomycetes are divided into two subclasses Exosporeae Rostaf. (i.e. Ceratiomyxa) and Myxogastria Fr. [8]. The primary phylogenetic bifurcation within Myxogastria is between the darkspored and bright-spored clades [2,9], superorders Columellidia and Lucisporidia respectively [8]. Lucisporidia has 34% of myxomycete species and is generally divided into two orders PLOS ONE | www.plosone.org 1 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Table 1. Systematic treatment of the class Myxomycetes (according to [12]), number of genera and species (according to Nomenmyx, http://eumycetozoa.com/data/index.php, updated 20.7.12) and percentage of genera and species sequenced in this study. Genera/ Species/ # Sequences obtained Order Family Authors Family Genus Authors Genus Genera Species Liceida Cribrariidae Corda 2 Cribraria Pers. 46 1 2 Lindbladia Fr. 1 1 1 1 2 Dictydiaethaliidae Nann.-Bremek. ex H. Neubert, Nowotny & K. Baumann 1 Dictydiaethalium Rost. 2 Liceidae Chevall. 1 Licea Schrad. 70 1 4 Listerellidae E. Jahn ex H. Neubert, Nowotny & K. Baumann 1 Listerella E. Jahn 1 0 0 Reticulariidae Chevall. 3 Lycogala Adans. 6 1 1 Reticularia Bull. 11 1 2 Tubifera JF.Gmel. 7 1 1 144 7 (87.5%) 13 (9.0%) Arcyodes OF.Cook 1 1 1 Arcyria FH.Wigg 49 1 3 Arcyriatella Hochg.& Gottsb. 1 0 0 Cornuvia Rostaf. 1 1 1 Perichaena Fr. 29 1 3 Calomyxa Nieuwl. 2 1 1 Dianema Rex 12 1 2 1 0 0 Total Liceida Trichiida Arcyriidae Dianemidae 8 Genera Rostaf. ex Cooke T. Macbr. 5 2 Minakatellidae Nann.-Bremek. ex H. Neubert, Nowotny & K. Baumann 1 Minakatella G. Lister Trichiidae Chevalier 6 Calonema Morgan 5 0 0 Hemitrichia Rostaf. 26 1 2 Metatrichia Ing 6 1 2 Oligonema Rostaf. 7 1 2 Prototrichia Rostaf. 1 1 1 Trichia Haller 33 1 4 Total Trichiida 14 Genera 174 11 (78.6%) 22 (12.6%) Total Lucisporidia 22 Genera 318 18 (81.8%) 35 (11%) doi:10.1371/journal.pone.0062586.t001 Its intrinsic features - such as length, branching patterns and surface ridges, are used to characterize families and genera in Trichiida. The order Liceida (with 5 families: Table 1) comprises such a variety of forms, sizes, and shapes that it has been long considered as heterogeneous [13,14]. It includes some of tiniest fruiting bodies, as in Licea (Fig. 1 F), and some of the largest, as those of the Reticulariidae (Fig. 1 C–E) and Dictydiaethalium (Fig. 1 G). In contrast, Trichiida appear to be more homogeneous as a whole, but distinctions between families and genera are difficult [13]. Accordingly, two (Dianemidae and Trichiidae) or three families (the same as above plus Arcyriidae) have been recognized. Similarly, the fourteen genera (Table 1) are difficult to delimit as many species possess features in common with two genera [13]. Currently, phylogenetic clarification of the position of Myxomycetes in Amoebozoa and investigation of their ecological role in soil is hampered by the lack of a sequence reference database: in the 101 small subunit (18S or SSU) ribosomal RNA gene PLOS ONE | www.plosone.org sequences reported [15] only 11 belong to the bright-spored Lucisporidia. To compensate for this bias, and to shed light on the taxonomic conundrum of Lucisporidia, we provide 66 small subunit rRNA (SSU) and elongation factor 1a (EF-1a) gene sequences for 81.8% of the genera of Lucisporidia (Table 1). Obtaining the sequences has been extremely difficult, due to their great genetic divergence, not only from the sister-clade Columellidia but also within the group. Our phylogenetic analyses of singleand two-gene trees lead to a congruent and mostly well-supported topology, which challenges the current classification and allows us to hypothesize evolutionary pathways. Materials and Methods Specimens All specimens were field-collected and deposited in herbaria (Table S1). To ensure a coherent approach for this taxonomically difficult group, all specimens were identified by the third author. 2 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Figure 1. SSU rRNA gene tree of Lucisporidia derived by Bayesian inference of 1325 nucleotide positions of 51 sequences, with Ceratiomyxa fruticulosa as outgroup. Species names are followed by GenBank accession number, except for sequences obtained during this study (in bold), whose accession numbers and collection sites are in Table S1. Clades are highlighted and labelled according to current classification or as new. Bayesian posterior probabilities (BPP)/ML bootstrap replicates (MLB) are shown for each branch; dashes indicate a conflicting topology in the ML tree; a dot on the line indicates maximum support in both analyses. The scale bar indicates the fraction of substitutions per site. Credit photos: A, F, G, J–M: Michel Poulain; B–E, H, I, N–P: Alain Michaud. doi:10.1371/journal.pone.0062586.g001 PLOS ONE | www.plosone.org 3 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Phylogenetic Analyses: SSU The present study used the Zoological Code for easier comparison with the latest classification at the high-taxon level [8], while descriptions and names of families and genera were based on the most recent treatise [12], modified with the Zoological Code endings. The TIM2 model taking into account a gamma-distributed rate heterogeneity among sites and a proportion of invariable sites (I+gamma) was selected using jModelTest 0.1.1 [18] under the Akaike Information Criterion (-ln Likelihood = 24300.743; proportion of invariable sites = 0.163; gamma shape = 0.581). Accordingly, the relative substitutions rates A–C (1.37) and A–T (1.56); C–G and G–T (both 1.00) were quite similar. Maximum likelihood (ML) analyses were run using Treefinder [19] with the TIM2+I model and a 4 rate categories gamma distribution, for 100 bootstraps replicates with the default settings, to obtain a 50% consensus tree (log likelihood = 224363.08). Bayesian analyses were run using MrBayes version 3.2 [20] with the GTR model and an 8 rate category gamma distribution. The GTR model estimates two rate parameters more than TIM2 (which cannot be implemented in MrBayes), but Bayesian inference is relatively robust to over-parameterisation (see the manual at http:// mrbayes.sourceforge.net/manual.php, last accessed 6.9.12). Two million generations were run, trees were sampled every 100 generations. Convergence of the two runs (Average Standard of Split Frequencies #0.01) was reached after 930000 generations; burnin was set accordingly leaving 10701 trees per run to be summarized (log likelihood = 224340.33, proportion of invariable sites = 0.158911, alpha = 0.575984, ESS min. value ,153). DNA Extraction, Amplification and Sequencing DNA was extracted from 5–6 adjacent sporophores (most probably arising from a single plasmodium), or from a portion of a large aethaloid fruiting-body, as previously described [16]. To obtain the highly divergent SSU sequences, specific primers had to be designed (Fig. S1). The presence of large introns, sometimes with strong secondary structure (especially intron S529) required the use of the ‘‘primer walking’’ method. For the EF-1a gene, in addition to already published primers [2,9] the following primers were used (59–39, ‘‘R’’ indicates a reverse primer): at the extremities of the gene, 1FTri GGTAAGTCAACCACCACTGG, 10RTri CATATCACGGACGGCAAAACG; in the middle of the gene: E6FBright AACAAGATGGAYGACAARTC, E8RBright CCRATACCTCCRATYTTGTA. In some cases, ‘‘primer walking’’ had also to be used. Amplification parameters were adapted according to the elongation time (depending on the length of the expected product, 1–2 min) and annealing temperature of the primers (52–58uC). Amplicons were purified using SureClean (Bioline) or with the PCR DNA and Gel Band Purification kit (GE Healthcare Life Science), then sequenced at various facilities (Department of Genetics and Evolution, University of Geneva; Zoology Department, Oxford University; and Zoology Institute, University of Greifswald). Sequences are deposited in GenBank under accession numbers JX481280– JX481345 (Table 1). Phylogenetic Analyses: EF-1a The best evolutionary model for amino-acids was estimated using MrBayes for 1 million generations. The Jones model was unambiguously selected (probability = 1.0, standard deviation 0.0). Under this model, the analysis was run on the freely available Oslo Bioportal at the University of Oslo (https://www.bioportal.uio. no/, last accessed Oct. 2012) for 4 million generations; trees were sampled every 100 generations. Stationarity (Average Standard of Split Frequencies #0.01) was reached after 2861000 generations, and burnin set accordingly, leaving 11391 trees per run to be summarized (log likelihood = 24210.14). Maximum likelihood (ML) analyses were run using Treefinder [19] with the same model, for 100 bootstrap replicates with the default settings, to obtain a 50% consensus tree. Alignments GenBank nucleotide database was searched for all sequences belonging to the orders Trichiales (or Trichiida) and Liceales (or Liceida). Half the 22 SSU sequences thus retrieved appeared actually to be fungi or other contaminants (Table S2), and one, Arcyria cinerea AF239231, although genuine, was too short to be included. Nineteen EF-1a sequences, on the other hand, although giving coherent BLAST matches, had to be excluded for insufficient length or quality, in particular because of the presence of indels disrupting the reading frame (Table S2). The genuine, high quality Lucisporidia sequences were aligned by hand to our existing myxomycete alignments, using BioEdit version 7.0.9 [17]. The final SSU alignment comprised 48 Lucisporidia taxa, plus 3 sequences of Ceratiomyxa fruticulosa as outgroup, in total 51 sequences. Because of the high divergence between sequences, only 1325 unambiguously aligned positions could be retained for phylogenetic analyses, most of the variable helices had to be excluded. Even so, the alignment displayed an astonishingly high variability (0 constant and 808 parsimony-informative sites, 929 site patterns). A proportion of gaps and completely undetermined characters of 8.14% was mainly due to the partial sequences of both Reticularia species. The final EF-1a alignment comprised 38 sequences of Lucisporidia plus 3 sequences of Ceratiomyxa fruticulosa as outgroup. All amino-acid positions could be unambiguously aligned; the final alignment comprised 380 positions showing little variation (26.1% constant and only 78 parsimony-informative sites, 203 site patterns). A proportion of gaps and completely undetermined characters of only 3.2% was mainly due to the partial sequences of Calomyxa metallica and Cornuvia serpula. PLOS ONE | www.plosone.org Phylogenetic Analyses: Combined SSU and EF-1a The two-gene alignment comprised 41 sequences and 1705 positions, with 1125 distinct patterns and a proportion of gaps and completely undetermined characters of only 8.11%. The same evolutionary models described above were applied on each partition. Mr Bayes was run on the Oslo Bioportal for three million generations; trees were sampled every 100 generations. Convergence of the two runs was reached after only 210000 generations, trees obtained before convergence were discarded as burnin, and the remaining 27901 trees per run were summarized (log likelihood = 225929.46, alpha SSU = 0.638744, alpha EF1a = 0.236029). Maximum likelihood analyses were conducted using RAxML version 7.2.8 [21], with 1000 rapid bootstrapping and subsequent thorough ML search, using the two distinct models with joint branch length optimisation (log likelihood = 225974.549151). SSU and EF-1a alignments are available as Supporting Information S1, S2, S3. Results Phylogenetic Analyses We obtained 66 new sequences, 37 SSU and 29 EF-1a for 35 taxa (Table S1). We assembled them with the few publicly available genuine, good-quality lucisporidian sequences in two 4 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes largest evolutionary distance lies between Cribrariidae and the remaining Lucisporidia (Fig. 1, Fig. 2). separate alignments and a combined one. The results of our phylogenetic analyses are presented as a SSU tree (Fig. 1) and a combined SSU+EF-1a tree with fewer taxa (Fig. 2). Both trees presented the same topology, but the second had increased support for the basal branches. On the other hand, the EF-1a gene alone is too conserved to provide enough informative sites, resulting in a tree with mainly unresolved branches, provided in Fig. S2. Both SSU and two-gene trees strongly place Cribrariidae as a monophyletic lineage sister to all other Lucisporidia (Bayesian posterior probabilities (BPP) 1.0; ML bootstrap replicates (MLB) 0.98%). These are divided into seven clades, with the holophyletic Reticulariidae sister to all the others (BPP 1.0; MLB 0.85). The remaining clades are named Liceidae (pro parte) (BPP 1.0; MLB 0.81), new clade 1, new clade 2, Arcyria, Perichaena and ‘‘Trichia and allied genera’’ (Fig. 1 and Fig. 2). Early Divergence of Cribrariidae and Derived Nature of Lindbladia The genus Cribraria Pers. stands out for its homogeneity and is distinctive in many traits, including pigments [30]. The sporophores are always stalked, except in Cribraria argillacea, where the stalk is short or missing (Fig. 1B). The stalked sporangium seems to represent the most ancestral condition for Myxomycetes, since it is also dominant in Echinosteliida, one of the two primary branches of Columellidia [2]. The peridium persists only as a more or less developed disc at the base of the sporotheca and otherwise as a net surrounding the spore mass (Fig. 1 A). Only six species of the family have been sequenced, and their reciprocal genetic distances are very large (long branches in Fig. 1, Fig. 2). Therefore it is not excluded that a more comprehensive sampling would alter the present picture, making taxonomic changes premature, including the elevation of the family to a higher rank. Cribraria argillacea and Lindbladia tubulina appear closely related, together forming a terminal branch of Cribrariidae (Fig. 1, Fig. 2). The monospecific genus Lindbladia Fr. was created to accommodate the aethaliate form of Lindbladia tubulina, which contrasts with the stalked sporophores of Cribraria. It was assumed that such distinct forms as aethalia and sporophores could not belong in the same genus [11]. Cribraria argillacea forms compact clusters of fruiting bodies, with or without a short stalk (an exception in this genus). Lindbladia tubulina shows a continuum of forms: compact clusters of fruiting bodies, with or without stalk, as in Cribraria argillacea, forms where the individual sporophores can hardly be seen and real, few centimetres large, pseudoaethalia (Fig. 1 B). Specimens with closely assembled sporocarps are difficult to assign to one species or the other [11]. Our results suggest that the pseudoaethalium of Lindbladia tubulina is a derived character in family Cribrariidae, and that Lindbladia may not deserve the rank of a genus. Group I Introns in the SSU We found 37 group I introns in all nine insertion sites previously recorded for Myxomycetes [22] and in a new site S1210. Introns had a mean length of 669 bp (maximum 1557 bp), representing up to 70% of the total sequence and were present in 18 sequences. The sequence of Licea marginata was remarkable for hosting seven introns, including S1210 (Table S3). The analysis of the sequence of Lma.S1210 (named according to [23]) revealed all characteristics of group I introns, i.e. nine paired elements (P1–P9), the P3– P7 pseudoknot (positions 3937–41 and 4008–12 of the sequence JX481296, see also Supporting information S1), the G binding site in the P7 (pos. 3935 and 4013), and the internal guide sequence at the end of the exon matching the 10th to 15th nucleotides of the intron (pos. 3656–61 and 3671–76). More precisely, the extended structures in the P2, P5 and P9 segments assign the intron Lma.S1210 to subgroup IC1 [24]. In addition, it shares with other myxomycete IC1 introns the absence of base pairing between the 39-exon and the internal guide sequence within the intron [25]: all these features make Lma.S1210 a typical group IC1 SSU myxomycete intron, in spite of its new insertion position (Fig. S3). Multiple Origins of Aethaloid Fructifications Spliceosomal Introns in EF-1a The large (1–10 cm) fruiting bodies called aethalia and pseudoaethalia have been suggested to have evolved by the coalescence of single fructifications [13]. Our results show that such forms are found in three distinct clades: in Cribrariidae (Lindbladia tubulina), in all Reticulariidae and in Dictydiaethaliidae (new clade 1) (Fig. 1, Fig. 2). In addition, they exist in all major divisions of dark-spored Myxomycetes (Fuscisporida), in Stemonitina in the ‘‘Comatricha’’ group (Brefeldia, Amaurochaete) and in both families of Physarina (Fuligo, Mucilago) (for their phylogenetic placement, see [16]). This widespread occurrence suggests multiple separate origins of aethaloid forms and convergent evolution. In Reticulariidae an interesting pattern, distinguishing pseudoaethalia from aethalia is observed. In one clade, consisting of Tubifera ferruginosa and T. dimorphotheca, the fruiting bodies are composed of closely compressed sporangia, retaining their peridium (pseudoaethalia) (Fig. 3 A, B). In the other clade, true aethalia are formed, as in Reticularia jurana, R. lycoperdon and Lycogala epidendrum, with fruiting body appearing as a large, single mass, where the individual sporangia cannot be distinguished (Fig. 3 C, D). An intron that seems to be obligatory for Myxomycetes was also present in all our new 29 sequences [2,9,26,27]. It lies at position 460 in the alignment provided (Supporting Information S2). Its very variable length ranges from 44 to 723 bp (in Lycogala epidendrum AMFD271). This insertion position is not unique to Myxomycetes [28]. Additional introns were found in three Cribrariidae: Cribraria violacea, C. tenella and Lindbladia tubulina. Discussion Paraphyly of the Two Orders in Lucisporidia The combination of the two genes produces a much better supported topology than each gene separately. Our results do not support the division of Lucisporidia into the two classical orders, Liceida and Trichiida being paraphyletic; the consistently although not well-supported new clade 1 has representatives of both classical orders (Fig. 1, Fig. 2). The validity of the absence of the capillitium to define Liceida has been questioned [13], since a capillitium may be present in Licea, Reticularia and Lycogala. In Licea the processes arising from the peridium of at least three species could be a rudimentary (or vestigial) capillitium [29], and in Lycogala epidendrum the so-called pseudocapillitium may be in fact true capillitium. In summary, the current taxonomy is based on assumptions that are neither supported by molecular phylogeny nor by morphology. Our phylogenies instead suggest that the PLOS ONE | www.plosone.org Ontogeny and Evolution of the Capillitium From the few studies on the ontogeny of the capillitium, at least two main patterns may be deduced: the capillitium can be laid down in anastomosing vacuoles (see, among others [31,32,33]) or 5 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Figure 2. Bayesian phylogeny of Lucisporidia inferred from concatenated alignments of SSU rRNA and EF-1a genes, based on 41 sequences and 1705 positions, with Ceratiomyxa fruticulosa as outgroup. Clades are highlighted as in Fig. 1. Bayesian posterior probabilities (BPP)/ML bootstrap replicates (MLB) are shown for each branch; a dot on the line indicates maximum support in both analyses. In Trichiida, classical families (according to [12]) are indicated by an ellipse with the initials (Arc = Arcyriidae; Dia = Dianemidae; Tri = Trichiidae). The scale bar indicates the fraction of substitutions per site. doi:10.1371/journal.pone.0062586.g002 PLOS ONE | www.plosone.org 6 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Figure 3. Pseudoaethalia and aethalia in Reticulariidae. A. Tubifera ferruginosa, pseudoaethalium seen from above. B. Vertical section showing sporangia surrounded by peridia; note the lack of capillitium in the spore mass. C. Lycogala epidendrum, aethalia seen from above. D. Vertical section of the same, with the spore mass blown away and the abundant pseudocapillitium. Scales and colours are approximate. Credit photos: Michel Poulain. doi:10.1371/journal.pone.0062586.g003 be redundant. In Reticulariidae, very different types of pseudocapillitium are found: in Lycogala, it is composed of hollow, branched tubes arising from the inner surface of the peridium [39] (Fig. 3 D); in Reticularia, it is a tridimensional network of more or less flattened structures. In the non-related Dictydiaethaliidae, the peridium persists at the top of the tightly compressed sporangia as a hexagonal plate, while the peridia between sporangia remain only as fine threads connecting the angles of the plate to the base of the pseudoaethalium (Fig. 4 A, B). TEM studies on capillitial ontogeny are needed to assess to what degree the structures referred to as pseudocapillitium in Reticularia, Lycogala and Dictydiaethaliidae are homologous, and how they are related with the different types of ‘‘true’’ capillitium. In new clade 1, Dictydiaethaliidae are associated with Dianemidae, Prototrichia metallica (with hollow capillitium) and Licea variabilis (lacking capillitium). A capillitium connecting the peridium to the base of the sporotheca is a characteristic common to Dianemidae and Prototrichia metallica (Fig. 5). Interestingly, a scanning electron microscopic study of several Trichiida recognized five groups of capillitium, the first three of which are found in new clade 1: Calomyxa metallica (Type I), Dianema (Type II), Prototricha metallica (Type III) [40]. This pattern supports the phylogenetic relationships of these species within new clade I (Fig. 1, Fig. 2). The question arises whether the capillitial Type I, II and III could be homologuous to the ‘‘peridial threads’’ of Dictydiaethalium. Should this be true, the fruiting bodies of Licea variabilis, Prototrichia metallica, Calomyxa metallica and Dianema spp. would be reduced aethalia (Fig. 2). in invaginations of the plasma membrane [34,35,36]. In the first process, which we call ‘‘vacuolar capillitium’’, the material that will form the capillitium is deposited at a very early stage of fruiting body development by incoming vesicles in vacuoles that anastomose to form a long row [32,35]. In the other form of capillitium development, which we call ‘‘peridial capillitium’’, capillitial threads are formed in connection with the developing peridium, by invaginations of the plasma membrane, and will stay connected with the peridium [37,38]. Both types of capillitium are found in classical Trichiida [33,35] and in Physarida [34,36]. Thus, both ways of capillitium deposition have been observed in Lucisporidia and in Fuscisporida. However, it is very hard to decide whether a capillitium was present ancestrally in Myxomycetes and was lost multiple times or whether it evolved convergently at least twice, in Lucisporidia and in Fuscisporida, or more times. If further ultrastructural studies revealed an ancestral origin, then in Lucisporidia the capillitium would have been lost without doubt in Cribrariidae, in Dictydiaethalium, Tubifera and in most Licea species. However, in Dictydiaethalium and Tubifera, Reticularia and Lycogala, filaments of probably diverse origins are referred to as ‘‘pseudocapillitium’’. The Identity of New Clade I and the ‘‘Pseudocapillitium’’ The term ‘‘pseudocapillitium’’ refers to filaments found in the aethaloid fructifications in Reticulariidae and Dictydiaethaliidae, regarded as the remnant of sporangial walls. From our results and from a critical analysis of morphological and ultrastructural past observations, it appears that distinct processes are jumbled under the name ‘‘capillitium’’, while the term ‘‘pseudocapillitium’’ may PLOS ONE | www.plosone.org 7 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Figure 4. Pseudoaethalium of Dictydiaethalium plumbeum. A. Pseudoaethalium seen from above. B. Vertical section with the spore mass partially blown away, showing the renmants of the peridia as hexagonal caps on the upper surface and vertical fine threads connecting them to the base of the fructification. Scales and colours are approximate. Credit photos: Michel Poulain. doi:10.1371/journal.pone.0062586.g004 clade 1, composed of species of Liceida and Trichiida (Fig. 1, Fig. 2). It should perhaps be placed in a new genus, possibly within a broadened Dianemidae, though this conclusion is tentative as our sampling still does not adequately reflect the variability of Licea, a large and heterogeneous genus, and the basal branching of clade 1 is only weakly supported. Licea and the ‘‘Protoplasmodium’’ Licea species share a common feature with Echinosteliida, that a single sporophore arises from a very small plasmodium: this tiny type of plasmodium has been considered primitive, and therefore named protoplasmodium [41], although it has been shown that, in Echinostelium, the plasmodium divides into small units before fruiting [42]. The ‘‘protoplasmodium’’ assumption is challenged by recent results: Ceratiomyxa fruticulosa, which forms large plasmodia [43], is sister to Myxogastria [2,8]. This lends support to ‘‘protoplasmodia’’ being derived and probably of independent origins in Licea and Echinostelium. In our tree, Licea would be monophyletic if L. variabilis were excluded. It has been suggested that Licea variabilis (Fig. 1 H), with fruiting bodies much larger (up to 1cm) than a typical Licea, should have been assigned to Perichaena [13], where a capillitium is sometimes absent. Our trees support the idea that Licea variabilis is misclassified, but not that it is a Perichaena. Instead we show here that Licea variabilis belongs to new PLOS ONE | www.plosone.org Families of Trichiida: Arcyriidae and Trichiidae There is no general agreement on the delimitation of Arcyriidae and Trichiidae: they have been separated on the basis of the nonbirefringence of the capillitium under polarized light [11,44], a character discarded by some authors, e.g. Lado et al. [10]. Nonetheless, it is generally accepted that in Trichiidae the capillitium is mostly made of isolated threads sculptured with spiral bands (Fig. 6 A), while in Arcyriidae it is mostly net-forming and smooth or variously sculptured with warts, rings or spines, but not with clear spiral bands [10,12] (Fig. 6 B). This classification is 8 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Figure 5. Dianema nivale, vertical section with the spore mass partially blown away, showing the capillitium connecting the peridium with the base of the fructification. Scale and colours are approximate. Credit photos: Michel Poulain. doi:10.1371/journal.pone.0062586.g005 Arcyria has mostly stalked sporophores, the peridium disappears but at the base [45], the capillitium is net-forming and never sculptured with spiral bands. The monospecific genus Arcyodes is distinguished from Arcyria by its thin, shining, persistent peridium and a very short (when present) stalk. Arcyodes nests well within Arcyria, jointly forming a clear monophyletic clade (1.0/97, Fig. 1). Arcyodes is specifically sister to a subset of Arcyria species that are pink or red. Our trees suggest that pigmentation may be more fundamental for subdividing this clade (white versus pink/red, Fig. 1) than the differences used to erect Arcyodes as a genus. Should this be confirmed by wider sampling, including yellow species, the genus Arcyodes may be abandoned. Perichaena is clearly a clade, and is characterized by the combination of generally branched capillitium lacking spiral bands and a thick, persistent peridium. It shares with Arcyria and Arcyodes the type IV capillitium (one layer, large lumen) (Fig. 2) [40]. ‘‘Trichia and allied genera’’ is composed of three subclades in the SSU tree (Fig. 1), with Trichia varia as sister of the other two. The ‘‘Trichia and allied genera’’ clade is neither robust nor wellsupported (0.67/2), but is corroborated by an ultrastructural character of the capillitium: species of Trichia, Metatrichia and Oligonema posses the type 5 (two layers and a narrow lumen) according to Ellis et al. [40] (Fig. 2). Only the Oligonema-containing subclade is robust and well-supported (0.98/85, Fig. 1): it includes Trichia scabra, T. alpina, T. persimilis, Oligonema schweinitzii and O. flavidum. The genus Oligonema is characterized by short capillitial threads, similar to those of Trichia, but lacking spiral bands (Fig. 6 C). In spite of this difference, the spores of Oligonema schweinitzii and challenged by the genus Metatrichia, possessing a branching capillitium with spiral bands, which has been alternatively placed in Arcyriidae or in Trichiidae [10,11,12]. Species with capillitium made of isolated threads but without spiral bands, as Oligonema (Fig. 6 C) or with Arcyria-like rings, as Cornuvia (Fig. 6 D), have nevertheless been included in Trichiidae. Our phylogenetic results do not support the existing demarcation between these two families; instead we see the emergence of several clades: new clade 2, Arcyria, Perichaena and ‘‘Trichia and allied genera’’. Their mutual relationships are not well-supported, except that Perichaena is robustly sister to ‘‘Trichia and allied genera’’, which contradicts its current placement in Arcyriidae. New Genera and Redundant Ones A previously unrecognised clade associates two Hemitrichia species, H. abietina and H. calyculata, with Trichia decipiens (although only well-supported in Bayesian analyses, Fig. 1:0.99/2, Fig. 2:1.0/0.59). In spite of their presently being in different genera, there is a striking characteristic shared by these three species: the stalk is filled with ‘‘spore-like bodies’’ (Fig. 7). These structures are formed during sporophore development by cleavage of the cytoplasm: the nuclei in the sporotheca will form spores, the ones in the stalk will become spore-like bodies [45]. The latter are larger than spores, multinucleate and highly vacuolated, and densely packed in the stalk [45] (Fig. 7). Spore-like bodies are characteristic of Arcyria and are also found in Licea operculata [29]. Establishing a new family for this clade will probably be appropriate but is premature before the type species Hemitrichia clavata is investigated, as well as sessile specimens of Hemitrichia. PLOS ONE | www.plosone.org 9 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Figure 6. Four different capillitial threads in Trichiida. A. Capillitial threads of Trichia varia: isolated threads sculptured with spiral bands, two very short ones are indicated by a black line. B. Capillitial threads of Arcyria obvelata, forming a network and sculptured with spines. C. Capillitial threads of Oligonema flavidum, short and in this case branched, smooth. Note the reticulate ornamentation of the spores, similar to that of Oligonema schweinitzii and Trichia persimilis. D. Capillitial threads of Cornuvia serpula, branched and ornamented with rings. Scale and colours are approximate. Credit photos: Michel Poulain. doi:10.1371/journal.pone.0062586.g006 Trichia persimilis are both reticulate (Fig. 6 C). It has been observed that Trichia persimilis, when exposed to severe changes of temperature at the time of fruiting, has produced very short capillitial threads with broad rings and faint spirals with much the same character as Oligonema schweinitzii, and some Trichia species have developed capillitium with ridges like that of Cornuvia [46]. This raises the possibility that Oligonema and Cornuvia are only aberrant developmental forms of extant Trichia species, though it is also possible that mutations could permanently mimc such aberrations in which case they could be genetically distinct. Although a wider phylogeny is needed to corroborate this hypothesis, our results already suggest that Cornuvia and Oligonema might be unneeded generic names. Since the type species of Trichia, Trichia varia, is in a poorly resolved position in the clade, changes appear premature. Summarizing, no character currently used for higher classification within Lucisporidia is apomorphic, and some monophyletic groups can only be defined by a particular assemblage of few characters: as an example, the new clade 2 is characterized by spore-like bodies in the stalk and capillitium with spiral bands, while Arcyria displays spore-like bodies and net-forming capillitium without spiral bands. PLOS ONE | www.plosone.org A group I Intron in a Previously Unrecorded Insertion Site Group I introns are the most abundant self-splicing introns [47], and 119 insertion sites are currently identified in the SSU (The Comparative RNA Web (CRW) Site, http://www.rna.icmb. utexas.edu/SAE/2C/rRNA_Introns/, accessed 17 Sep 2012). Group I introns IC1 have been found in position S1210 in 36 fungal sequences (The Comparative RNA Web (CRW) Site, http://www.rna.ccbb.utexas.edu/SAE/2C/rRNA_Introns/ accessed 17 Sep. 2012), but to date never in Myxomycetes, questioning the possible insertion mechanism and origin of the Licea marginata S1210. Two pathways are invoked to explain the spread of introns into ectopic sites: the first is reverse splicing of free intron RNA into the target RNA; the second is endonucleasemediated intron homing, with the homing endonuclease gene inserted in the intron sequence [48,49]. Currently, none of these pathways can be excluded to explain the Lma.S1210 insertion: the lack of the highly mobile homing endonuclease gene in itself is not conclusive, since it can be easily lost after the intron insertion [48]. Similarly, Lma.S1210 could have been gained by lateral transfer of a fungal S1210, or by ectopic transfer of a SSU intron. Answering these questions could be of general interest to help illustrating group I intron loss and gain. 10 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Figure 7. Spore-like bodies. A. Vertical section of the stalk and the base of the sporotheca of Hemitrichia calyculata, showing the stalk filled with spore-like bodies. Those are larger and clearer than the spores in the sporotheca above, without clear demarcation. B. Vertical section of the stalk and the base of the sporotheca of Trichia decipiens, showing the stalk filled with spore-like bodies and few capillitial filaments. C. Greater magnification of the spore-like bodies of Trichia decipiens. Scale and colours are approximate. Credit photos: Michel Poulain. doi:10.1371/journal.pone.0062586.g007 maximum support in both analyses. The scale bar indicates the fraction of substitutions per site. (PDF) Conclusion Our key findings are that Cribrariidae are deeply divergent from all other Lucisporidia and that the distinction between the orders Liceida and Trichiida is not supported. At the family level, Reticulariidae, Dictydiaethaliidae, Dianemidae and Liceidae (if Licea variabillis is excluded) are apparently holophyletic, but Arcyriidae and Trichiidae are jumbled. Several generic or familial boundaries will need revision in future, taking into account a combination of characters, not one character alone. We show the significance of some previously neglected features, like spore-like bodies in the stalk, the capillitium connecting the base of the sporotheca to the peridium, and pigmentation in Arcyria. The evolutionary path from individual sporophores to pseudoaethalia and aethalia is confirmed in two independent clades. Ancestral characters are the stalked, individual fruiting bodies arising from a large plasmodium, while small plasmodia giving rise to a single fruiting body are derived. Figure S3 Schematic secondary structure of the group I intron S1210 found in the SSU sequence of Licea marginata JX481296, according to [22]. The putative 59 and 39 splice sites (SS) are indicated by an arrow. Flanking exon sequences are in lowercase and outlined. The substrate domains (P1 and P2), the catalytic domains (P3, P7, P8 and P9) and the scaffold domains (P4, P5 and P6) are labelled. When the sequence is not shown, the length of the helix is given. (PDF) Table S1 List of new specimens used in this study, GenBank accession numbers and collection information. Herbaria: AMFD = Anna Maria Fiore-Donno, DWM = David Mitchell, HS = Hacène Seraoui, MM = Marianne Meyer, MS = Martin Schnittler. (PDF) Supporting Information Publicly available sequences not included in this study. A. Blast results of the 11 SSU sequences wrongly submitted as Lucisporidia (date: 6 Sep 2012). B. List of the EF-1a sequences too short or of poor quality (presence of indels and ambiguities). (PDF) Figure S1 A: List of the primers used in this study and their sequences (59–39). Colours match the regions in the diagram (B), showing the approximate position of the primers. New primers are in bold, for the others the reference is given. B: Schematic diagram of the SSU gene. Numbers indicate corresponding regions in the sequence of Physarum polycephalum X13160. Intron insertions positions are indicated by green bars and labels. (PDF) Table S2 EF-1a gene tree of Lucisporidia derived by Bayesian inference of 380 amino-acid positions of 38 taxa, with Ceratiomyxa fruticulosa as outgroup. Species names are followed by GenBank accession number, except for sequences obtained during this study (in bold), whose accession numbers and collection sites are in Table S1; Groups are labelled and highlighted as in Fig. 1, with labels in grey if appearing as polyphyletic, in black if monophyletic. Bayesian posterior probabilities (BPP)/ML bootstrap replicates (MLB) are shown for each branch; dashes indicate a conflicting topology in the ML tree; a dot on the line indicates Supporting Information S1 SSU alignment in fasta format of the 51 sequences used in Fig. 1. The first sequence indicates the positions retained for phylogenetic analyses. (FSA) Table S3 Figure S2 PLOS ONE | www.plosone.org Length, position and number of introns found in SSU sequences. (PDF) Supporting Information S2 EF-1a alignment (nucleotides) in fasta format of the 41 sequences used in Fig. S2. The probably obligatory spliceosomal intron starts at position 460. The first sequence indicates the nucleotide positions retained to obtain the amino-acid alignment (Supporting information S3). 11 May 2013 | Volume 8 | Issue 5 | e62586 Two-Gene Phylogeny of Bright-Spored Myxomycetes Eliasson and M. Poulain. Some of the analyses were run at the Bioportal at the University of Oslo, Norway (http://www.bioportal.uio.no, last accessed Oct. 2012). (FSA) Supporting Information S3 EF-1a alignment (amino-acids) in fasta format of the 41 sequences used in Fig. S2. (FSA) Author Contributions Edited the manuscript: TCS. Proofread the manuscript: MM MS. Conceived and designed the experiments: AMFD. Performed the experiments: AMFD FC. Analyzed the data: AMFD FC MM. Contributed reagents/materials/analysis tools: MM MS TCS. Wrote the paper: AMFD FC. Acknowledgments We are deeply grateful to Michel Poulain and Alain Michaud for the photos, to David Mitchell and El-Hacène Seraoui for providing specimens. A previous version of this manuscript benefited from suggestions of U. References 1. Stephenson SL, Fiore-Donno AM, Schnittler M (2011) Myxomycetes in soil. Soil Biol Biochem 43: 2237–2242. 2. Fiore-Donno A-M, Nikolaev SI, Nelson M, Pawlowski J, Cavalier-Smith T, et al. (2010) Deep phylogeny and evolution of slime moulds (Mycetozoa). Protist 161: 55–70. 3. Lahr DJG, Grant J, Nguyen T, Lin JH, Katz LA (2011) Comprehensive phylogenetic reconstruction of Amoebozoa based on concatenated analyses of SSUrDNA and actin genes. PLoS ONE. pp. e22780. 4. Shadwick LL, Spiegel FW, Shadwick JDL, Brown MW, Silberman JD (2009) Eumycetozoa = Amoebozoa?: SSUrDNA phylogeny of protosteloid slime molds and its significance for the amoebozoan supergroup. PLoS ONE. pp. e6754. 5. Hampl V, Hug L, Leigh JW, Dacks JB, Lang FB, et al. (2009) Phylogenomic analyses support the monophyly of Excavata and resolve relationships among eukaryotic ‘‘supergroups’’. Proc Natl Acad Sci USA 106: 3859–3864. 6. Wegener Parfrey L, Grant J, Tekle YI, Lasek-Nesselquist E, Morrison HG, et al. (2010) Broadly sampled multigene analyses yield a well-resolved eukaryotic tree of life. Syst Biol 59: 518–533. 7. Tekle YI, Grant J, Anderson RO, Nerad TA, Cole JC, et al. (2008) Phylogenetic placement of diverse amoebae inferred from multigene analyses and assesment of clade stability within ‘‘Amoebozoa’’ upon removal of varying rate classes of SSU-rDNA. Mol Phyl Evol 47: 339–352. 8. Cavalier-Smith T (2012) Early evolution of eukaryote feeding modes, cell structural diversity, and classification of the protozoan phyla Loukozoa, Sulcozoa, and Choanozoa. Eur J Protistol in press. 9. Fiore-Donno A-M, Berney C, Pawlowski J, Baldauf SL (2005) Higher-order phylogeny of plasmodial slime molds (Myxogastria) based on EF1-A and SSU rRNA sequences. J Euk Microbiol 52: 201–210. 10. Lado C, Pando F (1997) Myxomycetes, I. Ceratiomyxales, Echinosteliales, Liceales, Trichiales; Real Jardı̀n Botanı̀co de Madrid, editor. Madrid, Espana: Cramer, J. 324 p. 11. Neubert H, Nowotny W, Baumann K (1993) Die Myxomyceten Deutschlands und des angrenzenden Alpenraumes. Band I: Ceratiomyxales, Echinosteliales, Liceales, Trichiales. Gomaringen (D): K. Baumann Verlag. 343 p. 12. Poulain M, Meyer M, Bozonnet J (2011) Les Myxomycètes; Fédération Mycologique et Botanique Dauphiné-Savoie, editor. Sevrier, France. 13. Eliasson UH (1977) Recent advances in the taxonomy of Myxomycetes. Bot Notiser 130: 483–492. 14. Olive LS (1975) The Mycetozoans. New York: Academic Press. 293 p. 15. Pawlowski J, Adl SM, Audic S, Bass D, Belbahri L, et al. (2012) CBOL Protist Working Group: Barcoding eukaryotic richness beyond the animal, plant and fungal kingdoms. PloS Biology. pp. e1001419. 16. Fiore-Donno AM, Kamono A, Meyer M, Schnittler M, Fukui M, et al. (2012) 18S rDNA phylogeny of Lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa). PLoS ONE. pp. e35359. 17. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. 18. Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25: 1253–1256. 19. Jobb G (2008) TREEFINDER version of October 2008. Munich, Germany: Available: www.treefinder.de. 20. Huelsenbeck JP, Ronquist F Mr Bayes v3.0b4. Available: http:// morphbankebcuuse/mrbayes/infophp. Accessed 2012 Oct. 21. Stamatakis A, Ludwig T, Meier H (2005) RAxML-III: A fast program for maximum likelihood-based inference of large phylogenetic trees. Bioinformatics 21: 456–463. 22. Lundblad EW, Einvik C, Ronning S, Haugli K, Johansen S (2004) Twelve group I introns in the same pre-rRNA transcript of the myxomycete Fuligo septica: RNA processing and evolution. Mol Biol Evol 21: 1283–1293. 23. Johansen S, Haugen P (2001) A new nomenclature of group I introns in ribosomal DNA. RNA 7: 935–936. 24. Michel F, Westhof E (1990) Modelling of the three-dimensional architecture of group I catalytic introns based on comparative sequence analysis. J Mol Biol 216: 585–610. PLOS ONE | www.plosone.org 25. Haugen P, Coucheron DH, Ronning SB, Haugli K, Johansen S (2003) The molecular evolution and structural organization of self-splicing group I introns at position 516 in nuclear SSU rDNA of Myxomycetes. J Euk Microbiol 50: 283– 292. 26. Fiore-Donno AM, Novozhilov Y, Meyer M, Schnittler M (2011) Genetic structure of two protist species (Myxogastria, Amoebozoa) suggests asexual reproduction in sexual amoebae. PLoS ONE. pp. e22872. 27. Fiore-Donno AM, Haskins EF, Pawlowski J, Cavalier-Smith T (2009) Semimorula liquescens is a modified echinostelid myxomycete (Mycetozoa) Mycologia 101: 773–776. 28. Baldauf SL, Doolittle WF (1997) Origin and evolution of the slime molds (Mycetozoa). Proc Natl Acad Sci USA 94: 12007–12012. 29. Gilert E (1997) Morphological and ultrasctructural features in selected species of Licea (Myxomycetes) Nord J Bot 16: 705–709. 30. Iwata D, Ishibashi M, Yamamoto Y (2003) Cribrarione B, a new naphthoquinone pigment from the myxomycete Cribraria cancellata. J Nat Prod 66: 1611– 1612. 31. Harper RA, Dodge BO (1914) The formation of the capillitium in certain Myxomycetes. Ann Bot 28: 1–20. 32. Kalyanasundaram I (1973) Capillitial development in Stemonitis. In: Taxonomy of Fungi I. Subramanian C, editor: University of Madras, India. 9–13. 33. Mims CW (1969) Capillitial formation in Arcyria cinerea. Mycologia 61: 784–798. 34. Bisby G (1914) Some observations on the formation of the capillitium and the development of Physarella mirabilis Peck and Stemonitis fusca Roth. Am J Bot 1: 274–288. 35. Charvat I, Cronshaw J, Ross IK (1974) Development of the capillitium in Perichaena vermicularis a plasmodial slime mold. Protoplasma 80: 207–221. 36. Welden AL (1955) Capillitial development in the Myxomycetes Badhamia gracilis and Didymium iridis. Mycologia 47: 714–728. 37. Blackwell M, Alexopoulos CJ (1974) A study of sporophore development in the myxomycete Protophysarum phloiogenum. Arch Microbiol 99: 331–344. 38. Charvat I, Ross IK, Cronshaw J (1973) Ultrastructure of the plasmodial slime mold Perichaena vermicularis. II. Formation of the peridium. Protoplasma 78: 1–19. 39. Hatano T, Keller HW, Arnott HJ (1999) SEM observation on pseudocapillitium of Lycogala epidendrum (L.) Fries (Myxomycetes). Hikobia 13: 47–52. 40. Ellis TT, Scheetz RW, Alexopoulos CJ (1973) Ultrastructural observations on capillitial types in the Trichiales (Myxomycetes). Trans Amer Micros Soc 92: 65–79. 41. Alexopoulos CJ (1960) Gross morphology of the plasmodium and its possible significance in the relationships among the Myxomycetes. Mycologia 52: 1–20. 42. Haskins EF, Kerr NS (1978) Vergleich der Plasmodien-Typen und der Sporulation bei Myxomyceten (Film C 1220 des IWF, Göttingen 1976). Publikationen zu Wissenschaftlichen Filmen, Sektion Biologie, 11: 1–34. 43. Clark J, Haskins EF, Stephenson SL (2004) Culture and reproductive systems of 11 species of Mycetozoans. Mycologia 96: 36–40. 44. Nannenga-Bremekamp NE (1982) Notes on Myxomycetes. XXI. The use of polarized light as an aid in the taxonomy of the Trichiales. Proc Kon Ned Akad Wetensch, Ser C 85: 541–562. 45. Mims CW, Rogers MA (1975) A light and electron microscopy study of stalk formation in the Myxomycete Arcyria cinerea. Mycologia 67: 638–649. 46. Lister A (1894) A monograph of the Mycetozoa. London, UK: The British Museum. 224 p. 47. Cannone JJ, Subramanian S, Schnare MN, Collett JR, D’Souza LM, et al. (2002) The Comparative RNA Web (CRW) Site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs. BMC Bioinf. 48. Haugen P, Simon DM, Bhattacharya D (2005) The natural history of group I introns. Trends Genet 21: 111–119. 49. Bhattacharya D, Reeb V, Simon DM, Lutzoni F (2005) Phylogenetic analyses suggest reverse splicing spread of group I introns in fungal ribosomal DNA. BMC Evol Biol. 68. 12 May 2013 | Volume 8 | Issue 5 | e62586 Table SI. List of new specimens used in this study, GenBank accession numbers and collection information. Herbaria: AMFD = Anna Maria Fiore-Donno, DWM = David Mitchell, HS = Hacène Seraoui, MM = Marianne Meyer, MS = Martin Schnittler. Taxon Authors Herbarium # Date Place of collection Altitude Substrate (m) Lat. Long. GenBank accession # SSU EF-1alpha Arcyodes incarnata (Alb. & Schwein) O.F. Cook DWM2592 02/09/96 GB, W-Sussex, Billingshurst, Fishers Farm 28 Dead Fagus N 51.0240° W 0.4834° JX481280 Arcyria cinerea (Bull.) Pers. AMFD433 06/08/11 DE, Meckl.-Vorpommen, Greifswald 8 Decayed broadleaved log N 54.0824° E 13.4468° JX481281 JX481317 Arcyria globosa Schwein. AMFD252 17/08/05 MX, Hidalgo, Tlanchinol 1300 Dead leaves N 21.3667° W 98.050° JX481282 JX481318 Arcyria marginoundulata Nann.-Bremek. & Y.Yamam. MM37736 27/12/08 TH, rambutan bought in a French shop n/a Rambutan peel n/a n/a Calomyxa metallica (Berk.) Nieuwl. AMFD483 20/09/08 GB, Oxfordshire, Oxford 56 Living Sambucus nigra bark N 51.7642° W 01.2808° JX481284 JX481319 Cornuvia serpula (Wigand) Rost. MM29198 03/04/04 FR, Var, Port-Cros 10 Quercus ilex litter N 43.0067° Cribraria tenella Schrad. AMFD148 10/06/04 CH, Geneva, Céligny 450 Decayed log N 46.3651° E 06.1856° JX481286 JX481321 Cribraria violacea Rex AMFD172 03/10/04 IT, Puglia, Lecce 20 Cupressus sempervirens bark N 40.3822° E 18.2601° JX481287 JX481322 Dianema inconspicuum Poulain, Meyer & Bozonnet MM24067 11/06/04 FR, Savoy, La Bathie 1804 Vaccinium myrtillus N 45.6503° twigs E 06.4794° JX481288 JX481323 Dianema nivale (Meyl.) G.Lister MM 29888 18/06/06 FR, Savoy, Col de la Madeleine 1988 Dead branches N 45.4389° N 06.3775° JX481289 JX481324 Dictydiaethalium dictyosporum Nann.-Bremek. E 06.3975° JX481283 JX481285 JX481320 HS3379 04/10/08 NC, Numea, Buluparis n/a Log S 21.8360° E 166.1665° JX481290 Dictydiaethalium (Schum.) Rostaf. plumbeum AMFD185 AMFD185 06/11/04 CH, Geneva, Céligny 450 Broad-leaved stump N 46.3651° E 06.1856° JX481291 JX481325 Dictydiaethalium plumbeum MM30150 (Schum.) Rostaf. MM30150 27/11/06 FR, Savoy, Saint-Paul s/Isère 477 Broad-leaved branch N 45.6056° E 06.4406° JX481292 JX481326 Hemitrichia abietina (Wigand) G.Lister AMFD213 06/05/05 FR, Savoy, Essert-Blay 1650 Log N 45.6197° E 06.3962° JX481293 JX481327 Hemitrichia calyculata (Speg.) M.L.Farr MS 22060 22/10/10 DE, Meckl.-Vorpommen, Greifswald 10 Alnus glutinosa decayed log N 54.1278° E 13.3456° JX481294 JX481328 Licea castanea G. Lister AMFD102 13/11/02 GB, Yorkshire, Allerthorpe 24 Pinus decayed log N 53.9198° W 0.8497° JX481295 JX481329 Licea marginata Nann.-Bremek. DWM7368 05/10/08 GB, East Kent, Faversham 36 Quercus robur bark N 51.3027° E 00.8317° JX481296 JX481330 Licea parasitica (Zukal) G.W.Martin AMFD341 03/11/08 GB, East Kent, Faversham 36 Quercus robur bark N 51.3027° E 00.8317° JX481297 JX481331 Licea variabilis Schrad. MM28571 15/09/02 FR, Isère, Engins 967 Dead, standing Pinus N 45.1908° E 05.6177° JX481298 JX481332 Lindbladia tubulina Fr. AMFD228 11/08/05 MX, Tlaxcala, Tlaxco 2956 Log N 19.66498° W 98.0854° JX481299 JX481333 Lycogala epidendrum AMFD127 (L) Fries AMFD127 25/10/03 CH, Vaud, Allaman 400 Pinus log N 46.4671° E 06.4108° JX481300 Lycogala epidendrum AMFD271 (L) Fries AMFD271 30/09/07 DE, Saxony, Pirna 249 Decayed log N 50.9772° E 14.0389° JX481301 JX481334 Metatrichia floriformis (Schwein.) Nann.Bremek. MS24827 28/09/10 DE, Thüringen, Mihla 400 Decayed Fagus log N 51.0886° E 10.3767° JX481302 W 0.0878° JX481303 JX481335 Metatrichia vesparium (Batsch) Nann.Bremek. ex G.W. Martin & Alexop. DWM7019 21/09/05 GB, East Sussex. Ardingly 141 Betula N 51.0676° Oligonema flavidum DWM5764 14/08/99 US, Missouri, Mingo reserve 126 Decayed log N 36.9181° W 90.3694° JX481304 Oligonema schweinitzii (Berk.) Martin MM29842 04/05/06 MA, Kenitra, Mamora Forest 40 Quercus suber log N 34.2408° W 06.5654° JX481305 JX481336 Perichaena corticalis (Batsch.) Rost. AMFD157 15/11/03 CH, Geneva, Chancy 392 Populus log N 46.1358° E 05.9695° JX481306 JX481337 Perichaena depressa Lib. AMFD256 02/03/05 CH, Geneva, Pt-Lancy 411 Living Malus bark N 46.1927° E 6.1243° JX481307 Perichaena luteola (Kowalski) Gilert DWM4984 22/11/93 ES, Isla de la Palma n/a Mule dung n/a n/a JX481308 Prototrichia metallica (Berk.)Massee MM24907 06/05/05 FR, Savoy, Essert-Blay 1170 Twig N 45.6142° E 06.4139° JX481309 JX481338 Reticularia jurana Meylan AMFD290 25/08/07 GB, Kent, Lamberhurst 76 Broad-leaved log N 51.0936° E 0.4038° JX481310 JX481339 Reticularia lycoperdon Bull. AMFD262 11/04/07 GB, Yorkshire, York 30 Window frame N 53.9627° W 01.0788° JX481311 JX481340 Trichia alpina Meylan AMFD64 25/05/01 FR, Savoy, Col de Saisie 15/11/03 CH, Geneva, Chancy 1620 Living twig N 45.7453° E 06.539° JX481312 JX481341 (Peck) Peck Trichia decipiens (Pers.)Macbr. AMFD159 392 Populus log N 46.1358° E 05.9695° JX481313 JX481342 Trichia scabra Rostaf. MS22055 17/11/10 DE, Meckl.-Vorpommen, Neuenkirche 10 Decayed Betula log N 54.1256° E 13.3494° JX481314 JX481343 Trichia varia (Pers.) Pers. AMFD451 04/10/11 DE, Saxony, Grosser Zschand 264 Decayed log N 50.8997° E 14.2961° JX481315 JX481344 Tubifera dimorphotheca Nann.-Bremek. & Loer. AMFD251 17/08/05 MX, Hidalgo, Tlanchinol 1336 Decayed stump N 20.9843° W 98.6309° JX481316 JX481345 Table S2. Publicly available sequences not included in this study. A. Blast results of the 11 SSU sequences wrongly submitted as Lucisporidia (date: 6 Sep 2012). B. List of the EF-1alpha sequences too short or of poor quality (presence of indels and ambiguities). A GenBank Accession # Organism name Blast best hit AY145523 HM101143 JQ812659 AY237160 AY223841 AY145525 AY187083 DQ459629 JQ277925 JX273061 AF542044 AY187084 Arcyria cinerea Arcyria nigella Dianema subretisporum Hemitrichia clavata Hemitrichia serpula Lycogala flavofuscum Lycogala flavofuscum Lycogala flavofuscum Lycogala flavofuscum Lycogala sp. Metatrichia vesparium Trichia scabra Mattesia geminata AY334568 Taphrina johansonii AJ495835 Diderma meyerae JQ812626 Corydalis saxicola AY640053 Corydalis saxicola AY640053 Cordyceps cicadae DQ838788 Sporobolomyces folliicola AB021671 Sporobolomyces folliicola AB021671 Nectriopsis violacea AY489687 Uncultured fungus clone AB534515 Corydalis saxicola AY640053 Aspergillus penicillioides AB003077 E-Value % Identity % Coverage Belongs to (higher taxon) 0.0 2e-47 0.0 0.0 3e-95 0.0 0.0 0.0 0.0 0.0 0.0 0.0 79 85 100 84 81 99 99 99 97 99 89 100 100 21 (chimera?) 100 100 89 100 100 100 97 100 92 99 Alveolata, Apicomplexa Fungi, Ascomycetes Myxomycetes, Fuscisporida Plant, Papaverales Plant, Papaverales Fungi, Ascomycetes Fungi, Basidiomycetes Fungi, Basidiomycetes Fungi, Ascomycetes Fungi Plant, Papaverales Fungi, Ascomycetes Remarks B FJ546658 FJ546659 JQ277912 JF339220 FJ546665 FJ546672 FJ546676 JQ277910 JF263589 FJ546677 JF263590 FJ546678 JQ277908 FJ546690 FJ546691 FJ546692 FJ546673 FJ546674 FJ546675 Arcyria cinerea Arcyria denudata Arcyria obvelata Arcyria oerstedii Cribraria cancellata var. fusca Hemitrichia calyculata Hemitrichia clavata Hemitrichia clavata Lycogala conicum Lycogala epidendrum Lycogala flavofuscum Metatrichia vesparia (sic) Metatrichia vesparium Trichia alpina Trichia decipiens Trichia persimilis Trichia varia Trichia verrucosa Tubulifera arachnoidea (=Tubifera ferruginosa ) Length (nucleotides) Indels Ambiguities 616 707 365 329 540 709 600 362 570 719 546 1066 362 735 754 812 736 700 721 1 2 5 1 1 7 1 2 1 3 8 3 1 1 2 2 1 0 1 8 1 Indel disrupting the reading frame Too many ambiguities Unverified by GenBank staff Unverified by GenBank staff Last 16 bases not alignable First 90 bases not alignable Too short Unverified by GenBank staff Unverified by GenBank staff Indel disrupting the reading frame Unverified by GenBank staff Indel disrupting the reading frame Unverified by GenBank staff Too short Too short Indel disrupting the reading frame Indel disrupting the reading frame Indel disrupting the reading frame Indel disrupting the reading frame Table S3. Length, position and number of the 37 introns found in the SSU sequences. Taxon Introns names and length (nucleotides) S516 S529 S788 S911 S943 S956 S1065 S1199 new Arcyodes incarnata Arcyria cinerea Arcyria globosa 459 Arcyria marginoundulata Calomyxa metallica 662 Cornuvia serpula Cribraria tenella Cribraria violacea Dianema inconspicuum Dianema nivale 538 Dictydiaethalium dictyosporum Dictydiaethalium plumbeum AMFD185 Dictydiaethalium plumbeum MM30150 Hemitrichia abietina Hemitrichia calyculata Licea castanea Licea marginata 399 432 367 Licea parasitica 1149 1010 857 Licea variabilis Lindbladia tubulina 722 416 Lycogala epidendrum AMFD127 Lycogala epidendrum 778 AMFD271 Metatrichia floriformis 1060 Metatrichia vesparium Oligonema flavidum 663 Oligonema schweinitzii 1229 510 Perichaena corticalis Perichaena depressa Perichaena luteola Prototrichia metallica Reticularia jurana 996 478 Reticularia lycoperdon 494 Trichia alpina Trichia decipiens Trichia scabra Trichia varia 443 507 Tubifera dimorphotheca Total introns/position 8 5 2 6 S1389 533 1111 Total length: exon introns Total 2027 1863 1785 2027 1863 2244 1788 2169 1736 1417 2060 1501 2201 1801 459 1195 1111 538 1760 1 20 2 36 1 35 1 20 1760 1237 1763 1237 3000 1 41 413 1663 1203 1486 1893 1439 2116 2352 2678 413 1 20 2927 3314 7 4 61 70 908 1138 2076 1203 1486 4820 4753 2116 3260 3816 1 2 28 30 780 2888 1558 4446 2 35 514 1791 1941 1860 1690 1869 1768 1872 2232 717 877 1831 1906 1733 1934 2349 1574 3365 1941 2523 3962 1869 1768 1872 2232 2191 1371 1831 1906 1733 3865 3906 2 47 1 3 26 57 2 1 67 36 4 1 50 40 528 349 397 455 298 908 533 450 1557 1 1788 3364 1736 1417 3171 1501 2739 1801 Introns # % 8 531 1 3 1 2 663 2272 1474 494 1931 1557 Figure S1. A: List of the primers used in this study and their sequences (5'-3'). Colours match the regions in the diagram (B), showing the approximative position of the primers. New primers are in bold, for the others the reference is given. B: Schematic diagram of the SSU gene. Numbers indicate corresponding regions in the sequence of Physarum polycephalum X13160. Intron insertions positions are indicated by green bars and labels. A 1 S1 SFATri 1 SF1Tri 2 S4Bright S414F 1 1 S4 S4T S4Lic 718FTri 2 718FLic 2 718FCri 2 S11Tri 2 S11Cri 2 S11Ret S12Tri 2 S12Cri 2 S12Lyc 1 S13 S13.5 1 S14Tri 2 S14.5 1 S14.5Lyc S20Ret S26FTri S26FCri 2 S28Tri S30Cri FORWARD AACCTGGTTGATCCTGCC AATCTGCGAACGGCTCCGTA CGAACGGCTCCGTATATC TTYGRTCCTGGAGAGGTAGCC GAAGGCAGCAGGCGCGCAACG AGCAGGCGCGTAACGTTC TTACCCAATGCTAACACAGCG CAATTAGAGGACAAGTCTGG GTAATTCCAGCTCCAATAGCATCT GTAATTCCAGCTCTAATRGCATC CCGCGGTAATTCCAGCACT ATCAAGAACGAAAGTCTGGGG GGGCGAGGGGTGAAATCC GGTAGRGGTGAAATYCGTTGATC ATCAGATACCATCGTAGTCC GATTAGATACCGTTGTAGTC AGATACCACAGTAGTCCAGG GAGTATGGTCGCAAGGCTG GAAACTTAAAGGAATTGACGG TTGACGGAAGAGCACACAAGG TAATTTGACTCAACACGGGG TAAATTGACTCAACACGGGG GCCCGTCGCTCCTACCGATT TCAATAACAGGTCAGTGATGCC TGCAATAACAGGTCAGTGATG CAGTGATGCCCTTAGATGC CGTCGCTCCTACCGATTG REVERSE TGCTGGCACCAGACTTGT ACCGGACTTGTCCTCCAGT AGATGCTATTGGAGCTGGAATTAC CTACGAGCGTTTTAACYGCARCAA AAGGATCAACGGATTTCACCC GGATTTCACCCCTCGCCC TCACCTRGCGAGGATCAACG GATCAACGRATTTCACCYCTACC TTAGGGTCTGGACTACGATGG CTGGACTACTGTGGTATCTG GGAGTATGGTCGCAAGGCTG TTCAGYCTTGCGRCCATACTCC TTCAGTCTTGCGACCATACTCC AGGCTCCACTCCTTGTGTG GGTGGTGCATGGCCGTTC CACGAACTAAGAACGACCATGC GCTCGTTADCGGAATTAACCAGAC CATCACTGACCTGTTATTGACC AGCGCTAGCGAGGTTCCC AGAGCAGGGACAGAATCG GGTGTGTACAAAGAGCAGGG TGCAGGTTCACCTACGGATAC SR4Bright 1 SR4Lyc 718RTri 753RTri SR11Lic 2 SR11Cri 2 SR11Ent SR11Ret SR12Tri 2 SR12Lic 2 1 SR13 3 SR13U SR13Tri 2 SR14Tri 2 1 SR15U SR18Tri 2 SR18Ret 3 S26R SR27Lic SR29Tri SR30Tri 2 2 RibTri 1 2 3 Published in Fiore-Donno et al. 2008 Published in Fiore-Donno et al. 2010 Published in Fiore-Donno et al. 2012 B 100 200 300 400 500 600 S516 S529 700 800 900 1000 S788 1100 1200 1300 1400 S911 S956 S1065 S943 1500 1600 S1199 new S1215 1700 1800 S1389 1900 2000 Ceratiomyxa fruticulosa,CH6,EFC626-H Ceratiomyxa fruticulosa F,EFC626--, 65YA-65YA97 65YA-65YA99 Y5C4AM Y5HAM Ceratiomyxa fruticulosa CH4,EFC626-9 Lycogala epidendrum AMFD649,AY-74674S6/S4 Reticulariidae Lycogala epidendrum AMFD496 Arcyria denudata,AYH72-4Y, Arcyria globosa Arcyria Arcyria stipata,EFC626-2 Lindbladia tubulina Cribraria violacea Y5H2A97 Cribraria cancellata,AYH72-6C Y5CHAM Cribrariidae Cribraria argillacea EFC626-9 Cribraria tenella Y596AH9 Y594AC4 Cribraria vulgaris EFC6269Y Arcyria Arcyria cinerea Trichia decipiens New clade 2 Perichaena corticalis Perichaena Y59CAM Trichia varia Y594AM Trichia alpina 65YAM 65YAH6 Trichia persimilis AYH72-46 Metatrichia vesparium Y59-AM Trichia and allied genera Y59-AM Trichia sordida EFC624YY Y59HAM Cornuvia serpula 65YAHC Trichia scabra Y5H9AH9 Y5H6AC6 Oligonema schweinitzii Hemitrichia calyculata New clade 2 Tubifera dimorphotheca Reticulariidae 65YA96 Tubifera ferruginosa EFC624Y6 Licea castanea Liceidae 65YAM Reticularia lycoperdon 65YAM Reticulariidae 65YA99 Reticularia jurana New clade 2 Hemitrichia abietina Licea variabilis Liceidae Y5C4AM Dianemidae Calomyxa metallica New clade 1 Dictydiaethalium plumbeum AMFD6-C 65YAM 65YAM Dictydiaethalidae Dictydiaethalium plumbeum MM2Y6CY Y596AM Licea marginata Liceidae 65YAM Licea parasitica Y5-7AM Prototrichia metallica Dianema nivale New clade 1 Y5C4AM Dianemidae 0.1 65YA-Dianema inconspicuum Figure S2. EF -6alpha ,gene,tree,of,Lucisporidia,derived,by,Bayesian,inference,of,2-Y,amino acid,positions,of,2-,taxa/,with,Ceratiomyxa , fruticulosa,as,outgroup5,Species,names,are, , followed,by,GenBank,accession,number/,except,for,sequences,obtained,during,this,study,)in, boldT/,whose,accession,numbers,and,collection,sites,are,in,Table,S6;,groups,are,labelled,and, highlighted,as in,Fig5,6/,with,labels,in,grey,if,appearing,as,polyphyletic/,in,black,if, monophyletic5,Bayesian,posterior,probabilities,)BPPTAML,bootstrap,replicates,)MLBT,are,, shown,for,each,branch;,dashes,indicate,a,conflicting,topology,in,the,ML,tree;,a,dot,on,the,line indicates,maximum,support,in,both,analyses5,The,scale,bar,indicates,the,fraction,of, substitutions,per,site5 AC 24nt C G G P1 P5a P5 50 nt 5'SS C C A A A A G C- G C- G C- G P4 G -C C- G A - UCAA C C - GUCCA G P6 C G- C A G- C -C P6a G C- G G UU C A U U U-A u-G c-G c-G c-G g-C u-A A A A U A G A 41nt P2 44nt 3'SS g u a g a u A C A G P2.1 27nt - 18nt A G G G G C GGGGG A A U P5b P5c C A GCUCCC U G- C G- C C- G G A C C C C C U- G U- A G C P9 G- C A binding C- G G site U- A G- C P7 A- U U- A A G G- U C- G C- G P3 A- U C- G U- A A- U U- G U- G C- G G- U G- C P8 41nt Figure S3k6Schematic6secondary6structure6of6the6group6I6intron6S7W7P6found6in6the6SSU6 sequence6of6Licea marginata JX487W96w6according6to6vLundblad6et6alk6WPP45k6The6putative65T6 and63T6splice6sites6vSS56are6indicated6by6an6arrowk6Flanking6exon6sequences6are6in6lowercase6 and6outlinedk6The6substrate6domains6vP76and6PW5w6the6catalytic6domains6vP3w6P7w6P86and6P956 and6the6scaffold6domains6vP4w6P56and6P656are6labelledk6When6the6sequence6is6not6shownw6the6 length6of6the6helix6is6givenk6