Available online at www.sciencedirect.com Molecular Phylogenetics and Evolution 46 (2008) 878–889 www.elsevier.com/locate/ympev Evolution of dark-spored Myxomycetes (slime-molds): Molecules versus morphology Anna Maria Fiore-Donno a,c,*, Marianne Meyer b, Sandra L. Baldauf c, Jan Pawlowski a a University of Geneva, Department of Zoology and Animal Biology, 30, Quai E-Ansermet, 1211 Geneva 4, Switzerland b Le Bayet, 73730 Rognaix, France c Department of Biology, University of York, Box 373, Heslington, York YO10 5YW, UK Received 13 December 2006; revised 8 October 2007; accepted 11 December 2007 Available online 24 January 2008 Abstract The Myxomycetes are a major component of soil amoebae, displaying a complex life cycle that terminates in the formation of often macroscopic fruiting bodies. The classification of Myxomycetes is controversial and strongly depends on the weight given by different authors to morphological and developmental characters. We used a molecular approach to establish the phylogenetic relationships in the dark-spored orders Stemonitales and Physarales. Twenty-five small subunit ribosomal RNA gene sequences were obtained, with focus on two Stemonitales genera, Lamproderma and Comatricha. Unexpectedly, our results show that Stemonitales are paraphyletic with Physarales arising from within a Lamproderma clade. The genus Lamproderma itself is polyphyletic and can be divided into two distinct clades. Additionally, we found that Comatricha nigricapillitia comprises two cryptic species, both related to Enerthenema. Our study allows the reappraisal of morphological and developmental characters in the light of molecular data and sets foundations for a new classification of Myxomycetes. Ó 2007 Elsevier Inc. All rights reserved. Keywords: (Alphabetic) Amoebozoa; Comatricha; Lamproderma; Morphological evolution; Mycetozoa; Myxogastria; Phylogeny; Physarales; Slimemolds; Small subunit ribosomal RNA gene; Stemonitales 1. Introduction Myxomycetes are common soil microorganisms with a life cycle that includes a plasmodial trophic stage and fruiting bodies generally visible with the unaided eye. They represent one of the three major divisions of Mycetozoa, along with Protostelia and Dictyostelia. The current classification of Myxomycetes recognizes five orders: Physarales, Stemonitales, Trichiales, Liceales and Echinosteliales (Frederick, 1990; Neubert et al., 1993). Trichiales and Liceales are characterized by variously colored but never violet-brown or purplish-gray spores, while Echinosteliales present a * Corresponding author. Present address: Department of Zoology, University of Oxford, South Parks Road, Oxford 0X1 3PS, UK. Fax: +44 1865 281 310. E-mail address: afiore-donno6@infomaniak.ch (A.M. Fiore-Donno). 1055-7903/$ - see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2007.12.011 mixing of dark-spored (Clastoderma and Barbeyella) and colorless spores (Echinostelium) genera. Physarales and Stemonitales have dark spores (black, dark-brown, violet-brown, purplish-gray). Two main differences have been noted between the orders. One of these is the presence of lime deposits in one or several parts of the fructification in Physarales but their absence in Stemonitales. Although this trait is used as a key character, the pattern of fruiting body formation has been considered as an indicator of evolutionary pathway. Based on the unique, presumably primitive, mode of fruiting body formation, Ross (1973) proposed that the Stemonitales should be separated from the remainder of the Myxomycetes and placed as a sister group to the four remaining orders. This assumption has been rejected by earlier molecular analyses, which placed Stemonitales and Physarales together within the Myxomycetes (Fiore-Donno et al., 2005). In this A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 dark-spored clade, Stemonitales appear to be paraphyletic and basal to a monophyletic Physarales. Thus, Stemonitales stand in a key position from an evolutionary point of view, and we expect that by reconstructing their branching order we will obtain a clearer picture of dark-spored clade evolution. Stemonitales are particularly interesting from an ecological perspective. They comprise many nivicolous species, which live in high-latitude or -elevation grasslands and forests where winter snow pack has been present for at least three months (Meylan, 1931). In such sites, their sporophores can be found near the melting snow, throughout the world (Stephenson et al., 2000). It is probable that the amoeba live in the film of water under the snow banks, which hosts a wide diversity of bacteria (Lipson and Schmidt, 2004). An important question arising about nivicolous species that live in such harsh conditions is the supposed presence of asexually reproducing clonal strains intermingled with sexually reproducing populations (Clark, 2000). This assumption has not yet been tested, as all attempts reported so far to keep nivicolous species in culture have failed. However, if this assumption is true, wide morphological interspecific variation is expected, due to the existence of ephemeral genetically distinct strains. Notoriously, nivicolous species are difficult to determine, and many collections cannot be properly identified (Neubert et al., 2000). Although a good overall consensus exists concerning the delimitation of the order, there are disagreements regarding circumscription of genera within the Stemonitales (Eliasson, 1977). The key morphological characters used to distinguish genera intergrade into each other (Dennison, 1945a,b), to the extent that it has been asserted that any separation among the genera of Stemonitales would be artificial (Kowalski, 1970). As a solution to this problem, more genera have been created, emphasizing subtle differences in morphology (Nannenga-Bremekamp, 1967), but no general agreement has been reached. An exemplary case involves the genera Comatricha and Lamproderma, whose boundaries are not well defined. They share the common characteristics of generally stalked sporophores with a columella (Fig. 1). Kowalski (1968) affirmed that the only reliable character distinguishing the two genera is the branching pattern of the capillitium from the columella (from its whole length in Comatricha, only from the upper-third or the apex in Lamproderma) (Fig. 2), while he discarded the persistence of the peridium (evanescent in most Comatricha, persistent in most Lamproderma) as a valuable character. The difficulty in placement of Comatricha nigricapillitia exemplifies the problem and questions the reliability of this trait, which is prone to divergent interpretations. Comatricha nigricapillitia (Fig. 2) lacks a persistent peridium and possesses a unique, very dark and thick capillitium, bearing nodules or spinules towards its extremities. It is a rare nivicolous species, fruiting only on hard, decorticated dead wood. First described as a species of Lamproderma (Nannenga-Bremekamp, 879 Fig. 1. Sporophores of Lamproderma sauteri, describing its characteristics and showing the names of the different parts. Two major components can be distinguished: the stalk and the sporocyst. The sporocyst is composed by the peridium (a thin membrane), the capillitium (thread-like filaments), the columella (extension of the stalk into the sporocyst) and the spores. In the sporophore on the left, the peridium and the spores have been blown away, revealing the branching structure of the capillitium. Fig. 2. Main morphological characters distinguishing the genera Lamproderma, Comatricha and Collaria: (A) In Comatricha, the capillitium arises from the whole length of the columella. (B) In Lamproderma, the capillitium arises only from the upper part of the columella. (C) Collaria is defined by the presence of a peridial disc persisting at the base of the sporocyst, regardless of the capillitium branching pattern. The three drawings are made from a silhouette of C. nigricapillitia, showing that these characters are subject to diverging interpretations. 1989), it has been subsequently placed in Collaria (C. chionophila) (Lado, 1992) and Comatricha: C. chionophila (Illana et al., 1993). In yet another interpretation, C. nigricapillitia and C. chionophila have been considered as conspecific (Castillo et al., 1997). It has been argued that, if the abruptly ending columella and some remnants of silvery peridium are characters of Lamproderma, the non-persistence of the peridium and the capillitium arising from the upper half of the columella—and not from the whole length (Nannenga-Bremekamp, 1989)—are characters of Comatricha (Castillo et al., 1997) (Fig. 2). Here, we discuss the phylogenetic relationships among Stemonitales at genus and species levels, including the discovery of cryptic variation. We have sequenced and analyzed nearly complete small subunit ribosomal gene (SSU rDNA) sequences of 19 species of Stemonitales as well as 6 representative members of Physarales. Our analyses, although based on relatively few taxa, provide the first comprehensive phylogeny of Stemonitales and lay the 880 A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 foundation for the rationalization of morphological characters with the phylogeny. 2. Materials and methods 2.1. Collection, DNA extraction, amplification, cloning and sequencing We collected 22 species in four genera of the Stemonitales and six genera of Physarales from the field (Table 1). The samples were air dried and stored in cardboard boxes. DNA extraction was performed using several sporophores per sample. The spores were ground with a plastic pestle in an Eppendorf tube with 200 ll of the lysis buffer of the DNeasy plant mini-kit (Qiagen, Hilden, Germany). The pestle was attached to an electric hammer drill, and the proportion of broken spores was estimated under the microscope. This step (using the hammer drill) was performed on ice, to avoid melting the Eppendorf tube. The following DNA extraction steps were performed according to the manufacturer’s protocol. Due to the large size and important sequence divergence of myxogastrid SSU rDNA genes, including numerous introns, a number of different specific primers had to be designed (Table 2). Often a product was obtained only by using nested PCR. Amplification parameters were adapted accordingly—with elongation time adapted to the length of the expected product (1– 2 min), hybridization temperature according to the primers (50–53°). Cloning (when necessary), and sequencing were performed according to the manufacturer protocols (pGEM-T-Easy Vector System 1, Promega). New sequences reported in this paper have been deposited in the GenBank/EMBL database under Accession Nos. AY643823.1–AY643824.1, AY842030.1–AY842034.1 and DQ903668–DQ903689 (Table 1). All alignments are available as Supplementary material (Alignments 1 and 2). 2.2. Phylogenetic analysis Sequences were aligned by hand using Bioedit software 7.0.9.0 (Hall, 1999), following the secondary structure model of Physarum polycephalum (Johansen et al., 1988). Along with the 25 new/updated Stemonitales and Physarales sequences, we included 10 SSU rDNA sequences retrieved from GenBank (Table 1). In an alignment of 1215 positions, three Echinostelium sequences were included as outgroup. In the previous study, based on partial SSU rDNA and EF1A sequences, Echinostelium appeared as the sister group to the four remaining orders (Fiore-Donno et al., 2005). Currently, in analyses conducted with complete SSU rDNA sequences from a wider range of taxa, Echinostelium branches as the sister group of the dark-spored clade Physarales + Stemonitales (unpublished data), and thus it is the best candidate as outgroup. The tree resulting from analysis of 1215 sites (data not shown) places the root, with maximum support, between representatives of the L. atrosporum complex + L. fuscatum and the Stemonitales and Physarales clades. In additional analyses, in order to increase the number of aligned sites, we removed the Echinostelium sequences. We unambiguously aligned 1553 nucleotide positions from 22 taxa in Stemonitales and 13 in Physarales, keeping also the more variable, informative sections. We did not include sequences of species belonging to the genus Hyperamoeba (AF411289–90, AY321107–115 and AY62881) and Pseudodymium pseudomastigophorum (AY207466), which are listed as possible unidentified Physarales or Stemonitales. Phylogenetic trees were constructed using maximum likelihood (ML) and Bayesian inference (BI). ML trees were obtained using PhyML (Guindon and Gascuel, 2003) with the GTR model of substitution (Lanave et al., 1984; Rodriguez et al., 1990) and taking into account a proportion of invariable sites and a gamma-shaped distribution of the substitution rates across variable sites, with four rate categories (GTR+I+G model). We used a BIONJ distance-based starting tree with all model parameters estimated from the data. The same set of parameters, similarly estimated, were used to assess the reliability of internal branches with 1000 non-parametric bootstrap replicates using PhyML (Guindon and Gascuel, 2003). Bayesian inference analyses were conducted using MrBayes 3.1.1 software (Huelsenbeck and Ronquist, 2001). Analyses consisted of 1,000,000 iterations, using the GTR+I+G model as described above with trees sampled every 100 generations. Of the 10,000 trees sampled, 2000 were discarded as the burn-in, and the posterior probabilities of each node were estimated from the remaining trees. 3. Results 3.1. Sequence data We obtained 16 new Stemonitales SSU rDNA sequences (12 full-length and four partial), completed three already published (Fiore-Donno et al., 2005) partial sequences (Amaurochaete comata, Enerthenema papillatum and C. nigricapillitia 3), and obtained six new Physarales sequences. We have also completed three Echinostelium sequences (Table 1). The 25 complete sequences displayed a large range of sizes, from 1855 (A. comata) to 7257 nucleotides (Lepidoderma tigrinum), depending mostly on the number and length of introns, in the latter case representing 70% of the total sequence (see below and Table 3). The average GC content (calculated on the aligned positions used in phylogenetic analyses) was higher in Stemonitales (mean value = 52.89%) than in Physarales (mean value = 50.76%). Despite several attempts (i.e. two DNA extractions from each sample, amplification using all possible combinations of primers), we could not obtain sequences of any species of the genus Collaria (C. rubens, C. arcyrionema) nor from two different samples of Comatricha fusiformis or from two samples of the rare nivicolous species L. disseminatum. Table 1 Source of DNA samples in this work Genus Authors Stemonitales Amaurochaete comata G. Lister & Brandza Date Place of collection Enerthenema intermedium Rostaf. Enerthenema melanospermum Enerthenema papillatum T.Macbr.&G.W.Martin Comatricha nigra Comatricha nigricapillitia 1 Comatricha nigricapillitia 2 Comatricha nigricapillitia 3 Comatricha nigricapillitia 4 Comatricha pseudoalpina Lamproderma atrosporum var. aggregatum Lamproderma atrosporum var. retisporum Lamproderma fuscatum (Pers.)Rostaf. Meylan Meylan Meylan 22.05.01 France, Savoy, Hautecour 11.05.02 Italy, Cuneo, Sant’ Anna di Vinadio 08.05.04 Italy, Cuneo, Vallone dell’Ischiator 01.05.04 Switzerland, Glaris, Fronalp 08.05.03 France, Savoy, Méribel Lamproderma ovoideum s.str. Lamproderma sauteri Meylan 29.03.05 France, Savoy, EssertsBlay 08.04.05 France, Ain, Col Faucille Rostaf. 08.04.05 France, Ain, Col Faucille Lamproderma zonatum Mar.Mey.&Poulain 31.05.01 France, Savoy, Bonneval 46.20°N, 06.40°E 46.23°N, 05.97°E 45.57°N, 06.83°E 45.26°N, 06.22°E 45.57°N, 06.83°E 44.26°N, 07.08°E 45.65°N, 06.48°E 45.22°N, 05.15°E 45.26°N, 06.39°E 45.30°N, 06.32°E 44.26°N, 07.08°E 44.29°N, 07.07°E 47.08°N, 09.10°E 45.26°N, 06.39°E 45.37°N, 06.25°E 46.39°N, 06.12°E 46.39°N, 06.12°E 45.52°N, 06.45°E 950 360 2000 1900 GenBank Accession Nos. Dead log of Picea AY842031.1 abies Dead log of Populus DQ903683 nigra log DQ903685 AMFD171 AMFD155 MM 21077 DQ903686 MM 22123 AY643824.1 AMFD114 DQ903687 MM 28297 DQ903673 MM 23892 1700 Dead branch of PIcea Dead log of Pinus DQ903684 MM 24348 1850 Living bushes DQ903670 AMFD108 1700 Dead wood DQ903688 MM 21635 1900 Dead log of conifer DQ903689 MM 28388 1950 Conifer branch AY643823.1 AMFD141 1400 Living bushes DQ903669 AMFD135 1850 Salix branch DQ903671 AMFD173 1170 Small branches DQ903668 MM 24907 1275 Dead twigs on ground Litter on soil DQ903675 AMFD209 DQ903674 AMFD208 DQ903672 MM 21644 2126 2002 1614 1275 1800 Dead Alnus viridis branches Dead Pinus uncinata log Dead wood Voucher No. living Vaccinium uliginosum A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 Comatricha sinuatocolumellata Diacheopsis metallica 19.09.04 France, Haute-Savoie, StAndré Boëge (Pers.)J.Schröt. 15.11.03 Switzerland, Geneva, Chancy (Nann.-Bremek.&Bozonnet) A.Castillo, 17.05.00 France, Savoy, Les Arcs G.Moreno & Illana (Nann.-Bremek.&Bozonnet) A.Castillo, 21.05.02 France, Savoy, Col de la G.Moreno & Illana Madeleine (Nann.-Bremek.&Bozonnet) A.Castillo, 09.05.03 France, Savoy, Les Arcs G.Moreno & Illana (Nann.-Bremek.&Bozonnet) A.Castillo, 11.05.02 Italy, Cuneo, Vallone di G.Moreno & Illana Sant’ Anna G. Moreno, H. Singer, A. Sánchez & 16.05.04 France, Savoy, La Bâthie Illana G. Moreno, H. Singer, A. Sánchez & 07.06.04 France, Isère, Illana Chamrousse Meylan 08.05.03 France, Savoy, Méribel Coordinates Altitude Substrate (m) (continued on next page) 881 882 Table 1 (continued) Genus Date Pando & Lado 01.08.00 Russia, Volgograd Meylan 1450 Buyck 25.04.04 Switzerland, Jura, Col Marchairuz 08.05.03 France, Savoy, Rognaix H.Neubert, Nowotny& K.Baumann 15.11.03 Lepidoderma tigrinum (Schrad.) Rostaf. 06.11.04 Mucilago crustacea F.H.Wigg. 15.08.04 Physarum nutans Pers. 28.08.04 Macbrideola oblonga Physarales Badhamia panicea var. nivalis Diderma globosum var. europaeum Fuligo leviderma Echinostelium Echinostelium coelocephalum Echinostelium arboreum Echinostelium minutum Species from GenBank Didymium iridis Didymium nigripes Fuligo septica Fuligo sp. Physarum didermoides Physarum polycephalum Protophysarum phloiogenum Stemonitis axifera Stemonitis flavogenita Symphytocarpus impexus Place of collection Coordinates Altitude Substrate (m) GenBank Accession Nos. Voucher No. 48.80°N, 44.58°E DQ903682 leg:M.Schnittler Litter on soil DQ903680 MM 29328 1600 Vaccinum myrtillus DQ903677 AMFD110 360 AMFD130 391 Dead log of broad- DQ903676 leaved tree Dead log of broad- DQ903678 leaved tree Living plant DQ903679 MM 24347 400 Litter on soil DQ903681 AMFD168 Brooks & Keller AY842033.1 See Haskins et al. (2000) Keller & Brooks AY842030.1 de Bary AY842034.1 See Haskins and McGuinness (1989) ATCC No. 22345 (E. Haskins) E.Jahn (Ditmar) Fr. (Pers.) Rostaf. (L.) F.H.Wigg. Schwein. (Ditmar) Fr. M.Blackw. &Alexop. AJ938153 AF239230 AJ584697 AY145526 AY183449 X13160 AY230189 Ing & Nann.-Bremek. (Bull.)T.Macbr. M.Blackw. &Alexop. AY145528 AF239229 AY230188 46.54°N, 06.25°E 45.58°N, 06.45°E Switzerland, Geneva, 46.23°N, Chancy 05.97°E Switzerland, Geneva, 46.36°N, Céligny 46.18°E France, Savoy, St-Paul s. 45.25°N, Isère 06.26°E Fance, Haute-Savoie, 46.34°N, Chens-le-Pont 06.27°E 0 450 AMFD192 A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 Authors A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 Table 2 Primers used in this work 883 3.3. Phylogenetic analyses S1 S2 S3 SAPhy S414F S4Myx S4 718F 753F S11.5 S11atro S12m S120 Ste12 S13 S13.5 S14 S14.5 S15 S18 Forward AACCTGGTTGATCCTGCC TGGTTGATCCTGCCAGTAGTGT GATCCTGCCAGTAGTGTATGC AATCTGCGAACGGCTCCGC GAAGGCAGCAGGCGCGCAACG AGCAGGCGCGHAACGTTCC AGCAGGCGCGCAACGTTC TTCCAGCTCTAATAGCATACG GTTAAAACGCTCGTAGTCGGC GTGGTGAAATACGTTGACCC GACCTATGGCGAAAGCTG GACGATCAGATACCGTCGTAGTC CAGATACCGTCGTAGTCTTAAC CTATAAATGATACTGGCCAGG GAGTATGGTCGCAAGGCTG GAAACTTAAAGGAATTGACGG TTGACGGAAGGGCACACA TAATTTGACTCAACACGGGG TAAGTGGTGGTGCATGGTC TCTTAGTTCGTGGAGTGG SR19 718R 753R SR11 S900R SR12 SR13 SR14.1 SR15 SR15U SR18 S44R SRB Rib2 RibB Reverse ACAAGTCTGGTGCCAGCA CGTTAAAGTTGTTGCGGTTA GGTTAAAACGCTCGTAGTCGGC GTTCGAGGGTGACCGAATTCG CCCGTTGATCAAGAGCGAAAG GCGAAAGTTAAGGGTTCGAAG GGAGTATGGTCGCAAGGCTG CAAAGAGTGGAACCTGCGGC GTAAGTGGTGGTGCATGG GGTGGTGCATGGCCGTTC TCCGATAACGAGCGAGAC CAGTCATGCCCTTAGATGTTC GCCTAGAGGAAGCAGAAGTCG GGTAATCGTAGGTGAACCTGC GGTGAACCTGCAGAAGGATC The SSU rDNA tree (Fig. 3) shows three main groups of Stemonitales, a Lamproderma atrosporum clade, a Lamproderma ovoideum + Physarales clade and a Stemonitis + Comatricha (and allied species) clade. All of these are strongly supported by both maximum likelihood bootstrap (mlBP) and Bayesian posterior probabilities (biPP). The L. atrosporum clade is the sister group to all remaining species (100% mlPB, 1.0 biPP, Fig. 3), and appears genetically and morphologically well characterized and delimited (99% mlBP, 0.99 biPP). The second clade receiving strong support (100% mlPB, 1.0 biPP) is the one consisting of a distinct L. ovoideum s.str., L. zonatum, L. sauteri and Diacheopsis metallica group (95% mlBP, 1.0 biPP) plus the Physarales. Within this clade, Physarales form a consistent and monophyletic group, although with support of 0.94 biPP and 78% mlBP, while Protophysarum phloiogenum lies in a poorly resolved position (Fig. 3). Within the Physarales, the two represented families—Didymiaceae, represented by Lepidoderma tigrinum, Diderma globosum, Mucilago crustacea and two Didymium species, and Physaraceae, represented by Badhamia panicea, 3 Physarum and 2 Fuligo species—are recovered with maximum support (100% mlPB, 1.0 biPP, Fig. 3). The third major clade is composed of two strongly supported groups: the Stemonitis group (represented by Symphytocarpus impexus, Macbrideola oblonga and two Stemonitis species), and the C. nigricapillitia + Enerthenema spp. group. The sequences of Comatricha sinuatocolumellata, C. pseudoalpina and Amaurochaete comata lie between these two groups as a weakly supported clade (60% mlPB, 0.86 biPP, Fig. 3). 4. Discussion 3.2. Introns We found 44 introns in fourteen taxa (up to eight per SSU rDNA sequence) of a length varying from 333 to 1282 nucleotides, representing 22–74% of the sequence (Table 3). Comparison of these introns with those discovered in Fuligo septica (Physarales) (GenBank AJ584697) identifies them as group I introns, based on sequence similarities of the conserved short core positions. All these insertion sites for group I introns have already been reported in myxomycetes (Haugen et al., 2003; Lundblad et al., 2004). S1389 introns have been reported in Didymiaceae (Wikmark et al., 2007). We found 8 introns at this position, 2 in Didymiaceae, 1 in Physaraceae and 5 in Stemonitales. Investigations are in progress to seek their pattern of spreading (horizontal or inherited) and evolution of their structure. The longest intron (1282 nucleotides) is found in L. fuscatum at position 788 and contains a long open reading frame (ORF) on the anti-sense strand in the P9 region. The ORF seems to encode a homing endonuclease protein (His-Cys type) (S. Johansen, personal communication). Analyses of 39 SSU rDNA sequences yielded a well resolved tree (Fig. 3). Results from two different analytical methods gave strongly consistent results, revealing three major and six secondary clades (Fig. 3). The phylogenetic relationships among these clades interpreted in the light of morphology reveal two phylogenetically meaningful morphological characters: the stalk and the peridium. Based on our results, we tentatively suggest the evolutionary pathway that could have led to the morphology observed in these species (Fig. 4). 4.1. Importance of stalk formation This character confirms the current classification at the order level, allowing the distinction of the three orders that we examined, i.e. Echinosteliales, Stemonitales and Physarales (Fig. 4). This is consistent with the differences in the way in which the sporophores of Echinostelium, Stemonitales and Physarales develop. In both Echinostelium and Stemonitales, the stalk is secreted by the cytoplasm (Mims, 884 A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 Table 3 Location and length of the 44 SSU rRNA group I introns found in this work, named according to the corresponding position in Escherichia coli J01695 Species Intron position S516 S529 S788 S911 S943 S956 S1065 S1199 S1389 Stemonitales Comatricha nigra Comatricha pseudoalpina n/a Diacheopsis metallica Lamproderma atrosporum var. aggregatum 484 Lamproderma atrosporum var. retisporum Lamproderma fuscatum Comatricha nigricapillitia 1 489 Comatricha nigricapillitia 3 564 Lamproderma zonatum n/a Lamproderma sauteri Macbrideola oblonga 462 Physarales Diderma globosum var. europaeum Fuligo leviderma Lepidoderma tigrinum Physarum nutans Echinosteliales Echinostelium coelocephalum n/a 592 491 n/a 565 510 1282 534 n/a n/a 425 437 n/a n/a 338 n/a n/a 387 333 446 732 n/a n/a 457 n/a n/a 788 815 n/a n/a 566 696 n/a 402 1030 717 407 469 522 667 708 478 478 1136 1973; Spiegel and Feldman, 1988), but it is internally secreted in Stemonitales (Kalyanasundaram, 1973). In Physarales, it is merely a constriction of the cytoplasm and its surrounding membrane (Haskins et al., 1978) (Fig. 5). More precisely, when the sporophore initial rises from the substratum, the cytoplasm moves to the apex, the constricting and elongating stalk being filled up by food vacuole content—partially digested food material and a dense granular or fibrous component (Blackwell and Alexopoulos, 1974; Haskins and McGuinness, 1989). These three ways of building a stalk seem to be phylogenetically significant. The fact that internal secretion of the stalk is shared with the outgroup (Echinostelium), suggests that the peculiar Stemonitales stalk is an ancestral character in the dark-spored clade. Thus the stalked sporophore seems to be the ‘‘basic model” for the dark-spored clade. This character would then have been lost in the ancestor of Physarales (Fig. 4), as the Physarales appear to have evolved from within the Stemonitales. We suggest that the Physarales stalk is not directly related to the Stemonitales stalk, and has appeared after the loss of the latter (Fig. 4). Thus, the sessile morphology as in Diacheopsis metallica (L. ovoideum group, Fig. 3) is secondarily derived in Stemonitales, while it could be an ancestral character in Physarales. 4.2. The peridium: an essential, but neglected, character The three main clades revealed by our analyses are characterized by different types of peridium. These are (1) a splitting out peridium in the L. atrosporum group, (2) an evanescent peridium in the Stemonitis + Comatricha clade 434 356 417 241 438 434 543 1097 722 517 785 Number of Percent of introns/sequence intron/sequence (%) 1 4 1 2 5 1 2 1 3 5 2 28 74 33 46 57 40 36 22 49 55 37 1 5 8 2 28 56 70 43 1 31 and (3) a persistent peridium in the L. ovoideum + Physarales clade (Fig. 5). In the first group, characterized by the early evanescent and splitting out peridium, the capillitium tips retain parts of the peridium and therefore appear fan-shaped (Neubert et al., 2000; Martin et al., 2003) (Fig. 5). This unique diagnostic character is present in L. atrosporum (a complex of species) and L. fuscatum, but not in the other sampled Lamproderma, consistent with their molecular distinction (Fig. 3). Within this group, the species differ by color L. fuscatum being rust-brown, while L. atrosporum is black. The clade grouping the genera Stemonitis and Comatricha is composed of species with an early evanescent peridium, and forming sporophores generally on dead wood. The Stemonitis group is identified by its capillitium forming a superficial net. This character is also shared by another member of the Stemonitis group, Symphytocarpus impexus. SSU rDNA phylogeny also places Macbrideola oblonga within the Stemonitis group, a tiny species of a genus previously considered of uncertain value (Dennison, 1945b). This character of superficial net is missing from Comatricha, of which the analyzed species form two clades that can be tentatively recognized by the shape of the sporocyst—elongate in C. sinuatocolumellata and C. pseudoalpina, and globose in C. nigra, C. nigricapillitia and Enerthenema spp. The third clade is characterized by a persistent peridium and comprises some further ‘‘Stemonitales” and all Physarales, thus blurring the current order delimitation of the former. In the light of our results, the persistent peridium is a derived character that has appeared in a subgroup of the Stemonitales, probably in the branch leading to the L. ovoideum group. This character has been conserved in A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 885 Fig. 3. Small subunit (SSU) rDNA tree derived by maximum likelihood analysis (ML) and Bayesian inference (BI) of 1553 nucleotide positions. ML trees were obtained using PhyML (Guindon and Gascuel, 2003) with the GTR model of substitution (Lanave et al., 1984; Rodriguez et al., 1990) and taking into account a proportion of invariable sites and a gamma-shaped distribution of the substitution rates across variable sites, with four rate categories (GTR+I+G model). Bayesian inference analyses were conducted using MrBayes 3.1.1 software (Huelsenbeck and Ronquist, 2001). Analyses consisted of 1,000,000 iterations, using the GTR+I+G model as described above with trees sampled every 100 generations. The results of 1000 ML bootstrap replicates are shown below the lines as percentages, for values over 50% only. Bayesian posterior probabilities derived under the same model are shown above the lines. Branches with Bayesian posterior probabilities of 1.0 and bootstrap support values of 100% are indicated by thick lines. The root is drawn to scale (dotted lines) from a tree derived by maximum likelihood analysis of an alignment of 1215 positions, including three Echinostelium sequences as outgroup. 886 A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 Fig. 4. Schematic illustration of main morphological trends in evolution of the dark-spored Myxogastria. Similarities with the Echinostelium sister group suggest that the internal secreted stalk, typical of the Stemonitales, is an ancestral character. Within the dark-spored clade, the first branch is the L. atrosporum group, which possesses a splitting out peridium. The persistent peridium then arose along the branch leading to the group consisting of Lamproderma species possessing an iridescent peridium (L. ovoideum group) plus the Physarales. Thus, the formation of lime deposits must have appeared along the branch leading to Physarales, along with the phaneroplasmodium. As the internal secreted stalk is not found in Physarales, this peculiar feature must have been lost, replaced by the ‘‘peridial” stalk, possibly through an intermediate stalkless stage. The Stemonitales group devoid of persistent peridium (Stemonitis, Comatricha, Enerthenema) is also characterized by its ecological requirements, as this species are mainly, often exclusively, found on dead wood. Physarales, where it has become more thick and firm, and inlaid with lime (Fig. 4). An iridescence can also be observed in the inner membrane of the peridium of some Physarales species, for example in many Diderma. This suggests an affinity between L. ovoideum and Physarales that is strongly supported by SSU rDNA phylogeny (100% mlPB, 1.0 biPP, Fig. 3), and which had never been foreseen. This further may challenge the current delimitation of the orders Stemonitales and Physarales. The clade of Lamproderma with persistent peridium is composed of L. ovoideum and allied species (Lamproderma ovoideum s.str., L. zonatum, L. sauteri and Diacheopsis metallica) (100% mlPB, 1.0 biPP, Fig. 3). These are morphologically similar, having in common the capacity to form large developments, their fruiting bodies covering surfaces of up to several square meters (this characteristic is not unique to this group). These four species are considered as closely related, L. ovoideum being a complex of species (Kowalski, 1970) from which L. zonatum has been recently separated (Poulain et al., 2004). Meylan’s separation of Diacheopsis from Lamproderma on the basis of the mere absence of stalk is controversial (Dennison, 1945b) and is rejected by molecular phylogeny (100% mlPB, 1.0 biPP) and the fact that the species is otherwise very similar to L. ovoideum. The position of Protophysarum phloiogenum as the sister group of Physarales is interesting from the point of view of the peridium. This species has been placed in Physarales in spite of its lack of lime deposits (lime has been found in the mitochondria, though), but due to its lack of a columella (the capillitium branches from the apex of the stalk) and the presence of a phaneroplasmodium, it is considered as a primitive Physarales (Blackwell and Alexopoulos, 1975). The weak support for the position of this branch in the SSU rDNA tree (Fig. 3), does not allow us to be conclusive, but the presence of an iridescent peridium in this species backs up Blackwell’s assumption. 4.3. Inconsistence of the capillitium branching pattern The branching pattern of the capillitium is considered crucial in defining the genera Lamproderma and Comatricha within Stemonitales (Kowalski, 1968). However, it appears to be plesiomorphic and therefore not reliable for classification (Fig. 2) It has been observed that the capillitium branching pattern in Lamproderma is in fact related to the shape of the sporocyst: when globular, the capillitium arises from the upper part, while when more elongated, the capillitium arises from the whole length A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 Fig. 5. Stalk morphogenesis in: (A) Echinosteliales (Echinostelium minutum): stalk elongating. First, a bulge forms in the middle of the plasmodium, followed by the elongation of the stalk, tapering at the apex. The sporocyst does not change its form nor dimensions during this process. Drawings and text according to Haskins et al. (1978). (B) Stemonitales (Stemonitis fusca): internal secreted stalk. The columella develops along a central tract formed by the coalescence of cytoplasmic vacuoles. The material deposited in the vacuoles is not in contact with the plasma membrane. As it elongates, the cytoplasm withdraws from the base and moves up, exposing the stalk. The capillitium is deposited into radial tracks. (Kalyanasundaram, 1973). (C) Physarales (Didymium nigripes): peridial stalk. The stalk is formed by the constriction of the arising cytoplasmic bulge, in continuation with the peridium. In D. nigripes, the drying sporocyst sags around the stalk. Drawings and text according to Haskins et al. (1978). (M. Poulain, personal communication). It is not surprising in this respect that this character has been subject to divergent interpretations. 4.4. Cryptic speciation in C. nigricapillitia Comatricha nigricapillitia belongs to one of the Comatricha clades, which could be characterized by the globose shape of the sporocyst (Fig. 4). It is closely related to Enerthenema (100% BP, 1.0 biPP). The particularly close affinity between C. nigricapillitia isolates 2 and 4 and Enerthenema species is consistent with the difficulty in distinguishing these nivicolous species in the field (C. nigricapillitia, E. intermedium and E. melanospermum) when they grow intermingled, and when the typical apical disc of Enerthenema is not formed (Fig. 4). Microscopically, they share the presence of spinules toward the extremities of the capillitium. On the other hand, the capillitium in C. nigricapillitia is 887 thick and reticulate, while it is slender in Enerthenema (Fig. 4). In C. nigricapillitia, we found clearly two distinct clades differentiated only by their color. Isolates 2 and 4, collected in France and Italy (Table 1), display a dark-brown color in all their parts. These brown species are more closely related to Enerthenema (100% mlPB, 1.0 biPP, Fig. 3; 95.1% identities of the aligned sequences), than to the black C. nigricapillitia 1 and 3 (only 84.3% identities of the aligned sequences). The brown C. nigricapillitia do not show any other morphological difference from the typical black isolates. Thus these appear to be cryptic lower-rank taxa, showing a continuum of characters. Moreover, a previous study based on ribosomal ITS sequences suggested that some hidden genetic diversity may exist in some species of Lamproderma (Martin et al., 2003). The two nearly identical (99.9% identities of the aligned sequences) brown C. nigricapillitia isolates collected in two different countries suggest that these are not ephemeral clones. However, the SSU rDNA gene alone does not show enough variability to allow infra-species delimitation, which also requires a larger sampling. In contrast to the high genetic variability encountered in other species (e.g. C. nigricapillitia), the three examined species of Enerthenema possess nearly identical SSU rDNA sequences (99.6% identities of the aligned sequences). The two black nivicolous Enerthenema (E. melanosporum and E. intermedium) may constitute only one species, based on morphological and ecological similarities, while E. papillatum differs in respect to both habitat (not nivicolous) and color (brown). In Enerthenema spp., unlike their sister clade of C. nigricapillitia, the SSU rDNA phylogeny does not mirror the specific morphological and ecological differences. This suggests that the rate of evolution of the SSU rDNA may vary even between closely related groups of species. 4.5. Taxonomic implications and conclusions Our study confirms the necessity to revise the designation of Stemonitales as a subclass. This was originally based on the assumption that its peculiar sporophore development is primitive (Ross, 1973) and ignores the affinity between Stemonitales and Physarales (together forming the dark-spored clade). Within the Stemonitales, our results back up the proposition to erect the L. atrosporum complex as a genus on its own, called Meriderma ad. int. (Poulain et al., 2002). Its distinctive feature is the rapidly splitting out peridium, its fragments remaining attached to the extremities of the capillitium, thus appearing fanshaped (Fig. 4). The genus Lamproderma, as suggested by its name, should be restricted to species possessing a persistent peridium (L. ovoideum group), probably including Comatricha species sharing this characteristic (e.g. C. anastomosans) for which molecular data are not yet available. We also suggest the erection of the brown C. nigricapillitia as a new species. At the present stage formal taxonomic 888 A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 consequences or nomenclatural changes are not proposed, pending comprehensive monographs. Our study, based on the widest sampling obtained to date for Stemonitales and nivicolous species, lays down the basis for a more accurate taxonomy in identifying the molecular clades and allows a new insight into the evolutionary processes underlying sporophore morphology. Our results lead to the surprising discovery that Physarales arose from within Stemonitales and are sister taxon to a group of Lamproderma species possessing a persistent peridium. A second Lamproderma group (L. atrosporum clade) appears as the deepest branch in the dark spore clade. These results strongly reject Lamproderma as a monophyletic genus. A wider sampling will probably clarify certain relationships within groups but will not join these two distinct Lamproderma clades. Our results allow us to refute the suggestion that Comatricha, Lamproderma and Stemonitis completely intergrade into one another, and suggest some valuable characters to distinguish these genera. Acknowledgments This work has been supported by Ernst et Lucie Schmidheiny Fondation, Geneva and Swiss National Science Foundation postdoctoral grant PBSKA-110567 to AMFD. We sincerely thank José Fahrni and Jackie Guiard for technical assistance; M. Poulain for useful comments; Franz. von Niederhäusern, Prof. Martin Schnittler for providing samples. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ympev. 2007.12.011. References Blackwell, M., Alexopoulos, C.J., 1974. A study of sporophore development in the Myxomycete Protophysarum phloiogenum. Arch. Microbiol. 99, 331–344. Blackwell, M., Alexopoulos, C.J., 1975. Taxonomic studies in the Myxomycetes. IV. Protophysarum phloiogenum, a new genus species of Physaraceae. Mycologia 67, 32–37. Castillo, A., Moreno, G., Illana, C., Lago, J., 1997. A critical study of some Stemonitales. Mycol. Res. 101 (11), 1329–1340. Clark, J., 2000. The species problem in the Myxomycetes. Stapfia 73, 39– 53. Dennison, M.L., 1945a. The genus Lamproderma and its relationships. I. Mycologia 37, 80–108. Dennison, M.L., 1945b. The genus Lamproderma and its relationships. II. Mycologia 37, 197–204. Eliasson, U.H., 1977. Recent advances in the taxonomy of Myxomycetes. Bot. Notiser. 130, 483–492. Fiore-Donno, A.-M., Berney, C., Pawlowski, J., Baldauf, S.L., 2005. Higher-order phylogeny of plasmodial slime molds (Myxogastria) based on EF1A and SSU rRNA sequences. J. Eukaryot. Microbiol. 52 (3), 201–210. Frederick, L., 1990. Phylum plasmodial slime molds—class Myxomycota. In: Margulis, L., Corliss, J.O., Melkonian, M., Chapman, D.J. (Eds.), Handbook of Protoctista. Jones and Barlett, Boston, pp. 467–483. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52 (5), 696–704. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. 41, 95–98. Haskins, E.F., Kerr, N.S., Film, I.f.d.W., 1978. Vergleich der PlasmodienTypen und der Sporulation bei Myxomyceten (Film C 1220 des IWF, Göttingen 1976). Pub. Wissensch. Film., Sek. Biol. 11 (27), 1–34. Haskins, E.F., McGuinness, M.D., 1989. Sprorophore ultrastructure of Echinostelium arboreum. Mycologia 82 (2), 303–307. Haskins, E.F., McGuinness, M.D., Clark, J., 2000. Heterothallic mating systems in the Echinosteliales II. Echinostelium coelocephalum. Mycologia 92 (6), 1080–1084. Haugen, P., Coucheron, D.H., Ronning, S.B., Haugli, K., Johansen, S., 2003. The molecular evolution and structural organization of selfsplicing group I introns at position 516 in nuclear SSU rDNA of Myxomycetes. J. Eukaryot. Microbiol. 50 (4), 283–292. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Illana, C., Moreno, G., Castillo, A., 1993. Spanish Myxomycetes. VIII. Some nivicolous Myxomycetes from Central Spain. Cryptogamie Mycol. 14 (4), 241–253. Johansen, T., Johansen, S., Haugli, F.B., 1988. Nucleotide sequence of Physarum polycephalum small subunit ribosomal RNA as inferred from the gene sequence: secondary structure and evolutionary implications. Curr. Genet. 14, 265–273. Kalyanasundaram, I., 1973. Capillitial development in Stemonitis. In: University of Madras (Ed.), Taxonomy of Fungi I. India, pp. 9-13. Kowalski, D.T., 1968. Observations on the genus Lamproderma. Mycologia 60, 756–768. Kowalski, D.T., 1970. The species of Lamproderma. Mycologia 62 (4), 621–672. Lado, C., 1992. Collaria chionophila, a new myxomycete from Spain. An. Jard. Bot. Madrid 50 (1), 9–13. Lanave, C., Preparata, G., Saccone, C., Serio, G., 1984. A new method for calculating evolutionary substitution rates. J. Mol. Evol. 20, 86–93. Lipson, D.A., Schmidt, S.K., 2004. Seasonal changes in an alpine soil bacterial community in the Colorado rocky mountains. Appl. Environ. Microbiol. 70 (5), 2867–2879. Lundblad, E.W., Einvik, C., Ronning, S., Haugli, K., Johansen, S., 2004. Twelve group I introns in the same pre-rRNA transcript of the myxomycete Fuligo septica: RNA processing and evolution. Mol. Biol. Evol. 21 (7), 1283–1293. Martin, M.P., Lado, C., Johansen, S., 2003. Primers are designed for amplification and direct sequencing of ITS region of rDNA from Myxomycetes. Mycologia 95 (3), 474–479. Meylan, C., 1931. Les espèces nivales du genre Lamproderma. Bull. Soc. Vaud Sci. Nat. 57 (228), 359–373. Mims, C.W., 1973. A light and electron microscopic study of sporulation in the Myxomycete Stemonitis virginensis. Protoplasma 77, 35–54. Nannenga-Bremekamp, N.E., 1967. Notes on Myxomycetes. XII. A revision of the Stemonitales. Proc. Koninklijke Ned. Ak. van Wetenschappen 70 (2), 201–216. Nannenga-Bremekamp, N.E., 1989. Notes on Myxomycetes XXIII. Seven new species of Myxomycetes. Proc. Koninklijke Ned. Ak. van Wetenschappen 94 (4), 505–515. Neubert, H., Nowotny, W., Baumann, K., 1993. Die Myxomyceten Deutschlands und des angrenzenden Alpenraumes. Band I: Ceratiomyxales, Echinosteliales, Liceales, Trichiales. Karlheinz Baumann Verlag, Gomaringen, D. pp. 343. Neubert, H., Nowotny, W., Baumann, K., 2000. Die Myxomyceten Deutchlands und des angrenzenden Alpenraumes. Band 3: Stemonitales. Karlheinz Baumann Verlag, Gomaringen, D. pp. 391. A.M. Fiore-Donno et al. / Molecular Phylogenetics and Evolution 46 (2008) 878–889 Poulain, M., Meyer, M., Bozonnet, J., 2002. Lamproderma nivicoles du groupe atrosporum Meylan. In: Rammeloo, J., Bogaerts, A. (Eds.), Fourth International Congress on Systematics & Ecology of Myxomycetes, Meise, National Botanic Garden of Belgium, Belgium, pp. 74–75. Poulain, M., Meyer, M., Moreau, P.-A., 2004. Étude des types de Lamproderma sauteri et de Stemonitis carestiae Validation de Lamproderma zonatum sp. nov. Bull. Soc. Mycol. France 119, 267–278. Rodriguez, F., Oliver, J.L., Marin, A., Medina, J.R., 1990. The general stochastic model of nucleotide substitution. J. Theor. Biol. 142, 485– 501. 889 Ross, I.K., 1973. The Stemonitomycetidae, a new subclass of Myxomycetes. Mycologia 65, 477–485. Spiegel, F.W., Feldman, J., 1988. Fruiting body development in the mycetozoan Echinostelium bisporum. Can. J. Bot. 67, 1285–1293. Stephenson, S.L., Novozhilov, Y., Schnittler, M., 2000. Distribution and ecology of myxomycetes in high-altitude regions of the Northern Hemisphere. J. Biogeogr. 27 (3), 741–754. Wikmark, O.-G., Haugen, P., Lundblad, E.W., Haugli, K., Johansen, S., 2007. The molecular evolution and structural organization of group I introns at position 1389 in nuclear small subunit rDNA of Myxomycetes. J. Eukaryot. Microbiol. 54 (1), 49–56.